Ebola [OFFICIAL THREAD]

**hasanhh** · July 27, 2014

(salam)

(bismillah)

So as of Sunday night, 27July14/30Ramadhan35 the death toll in West Afrika is 672 according to CBSNews.

And of course, while the CDC is busy, there appears to be no sense of urgency among Western Leaders.

Which will change as soon as in lands in their country.

In the mean time, we can all raise awareness by wearing patches, buttons, raising placards, bumper stickers...

Medicines sans Frontiers works in these areas and with Marburg hemorrhagic fever, so send donations to them.

El Cid · July 31, 2014

Why did all diseases come from Africa? Aids, ebola, dengue. And they get offended when we bring it up.

**Marbles** · July 31, 2014

On 7/30/2014 at 10:45 PM, El Cid said:

Why did all diseases come from Africa? Aids, ebola, dengue. And they get offended when we bring it up.

Dengue has more likely Asian origins.

El Cid · July 31, 2014

On 7/31/2014 at 2:53 AM, Marbles said:

Dengue has more likely Asian origins.

Contracted from animals exported from Africa. Rampant in brazil too

**Ethics** · July 31, 2014

Sierra Leone declares Ebola public health emergency

Little_Socrates · August 1, 2014

IFK · August 1, 2014

Salam,

Isn't there a hadith that sickness will kill 1/3rd of the world and war will kill another 1/3rd? Between Ebola and MERS, there seems to be enough going on..

Is this before the re-appearance of the Imam ajf or after the arrival and before the Day of Judgment?

**hasanhh** · August 1, 2014

(salam)

The prepare some things in advance is generally good advice for tornadoes, weather related disasters, as well as disease.

The film talked about airborne droplets, and that the disease travelled between hogs and apes.

I read this week that dogs will carry it but remain "unaffected". A news article this was. Can't remember which one.

Because the disease is also transmitted by sweat, this makes it a casual contact disease, and the NPR Diane Rheims Show on Thursday the 31st the guest said this is true when "there is a break in the skin" to allow infection.

I'd also have a rifle around incase society breaks down. Organize around the local police.

blu115 · August 1, 2014

Read The Hot Zone by Richard Preston

Edit

One of the world's top Ebola specialists has died due to being infected.

Also, this time around even to your average person living in the west, this outbreak looks serious, especially considering events occuring today.

Peace and blessings be upon Prophet Muhammad (sawaws) and his Family.

May Allah keep safeguard over me and my family and friends.

Edited August 1, 2014 by blu115

Deewan · August 1, 2014

Just a piece of advice, trust the "so called public health officials" who are risking their lives fighting ebola over some random nutjob who makes his living by posting conspiracy theories on a wide variety of topics on YouTube.

blu115 · August 1, 2014

Just a piece of advice, trust the "so called public health officials" who are risking their lives fighting ebola over some random nutjob who makes his living by posting conspiracy theories on a wide variety of topics on YouTube.

The guy is right though, this is one of the worst ebola outbreaks in history so we cant just dismiss this video.

monad · August 1, 2014

Dewaan, one could consider you a , generally individuals in the medical field get upset, by such conspiracy theories, because it tends to instigate them with the corrupters. There are always more then one side to a story, and generally these crazy Conspiracy theorists, break the main stream propaganda indoctrination.

For example, the media is always bias towards israel, yet, why do individuals such as yourself deny their truth?. They are the mainstream, therefore it must be the truth.

Edited August 5, 2014 by Haji 2003
please don't call other members names.

**Abu Hadi** · August 2, 2014

If you are in West Africa, yes you should be worried about this and be careful. May Allah(s.w.a) help the brothers and sisters there. But it has not spread other places, so not yet a global pandemic.

Edited August 2, 2014 by Abu Hadi

**Haydar Husayn** · August 2, 2014

There is always something we aren't been told about...

godzapostle · August 4, 2014

If doctors werent frantically trying to save those already infected then these people would have died and the disease would have stopped spreading and died along with them. Now that they're trying to save the infected they are putting even more people at risk. The whole area should just be quarantined until a vaccine is developed. Its not as if the doctors are doing much good anyway, their efforts are futile until a vaccine can be developed.

**hasanhh** · August 4, 2014

blu115: I read that back in 1999. Good book. Remember how the Army tried to keep things secret during the Ebola Reston outbreak??

**hasanhh** · August 4, 2014

(salam)

Here is an article from Mirror,

"Ebola Terror at Gatwick as Passenger Collapses and Dies getting off Sierra Leone Flight", by Rebecca Younger 03Aug14

The woman was 72 and showed no symptoms until near airport.

Not enough resources ( read 'care') being displayed by int'l community.

eThErEaL · August 4, 2014

Yes. I really was of the impression that Ebola was airborne.

**hasanhh** · August 4, 2014

(salam)

eThErEaL: After I wrote the above, a doctor on TV said that you can get it -airborne- with face to face contact, but not if you are in the next room.

On NPR today, the test serum of lab produced monoclonal antibodies has shown some positive effect on the two patients at Emory.

One patient got a blood transfusion from a 14 year-old boy who survived the disease.

Deewan · August 5, 2014

The guy is right though, this is one of the worst ebola outbreaks in history so we cant just dismiss this video.

Dewaan, one could consider you a nut job, generally individuals in the medical field get upset, by such conspiracy theories, because it tends to instigate them with the corrupters. There are always more then one side to a story, and generally these crazy Conspiracy theorists, break the main stream propaganda indoctrination.

For example, the media is always bias towards israel, yet, why do individuals such as yourself deny their truth?. They are the mainstream, therefore it must be the truth.

Oh for God's sake. You're defending an obvious imbecile who has no knowledge of the medical principles at work. The guy takes one highly publicized experiment, whose results haven't really been replicated anywhere else and claims people aren't being told things. I find it hilarious that you question the medical profession, especially those in public health who more than any other branch of the profession put their lives at risk, but don't hesitate from believing the guy who is obviously making money by publishing YouTube videos on doomsday scenarios about every topic imaginable and then asking people to visit his site for more info so he can garner even more revenue by displaying ads there.

Again, read the God-damn article he repeatedly cites. It's own authors speculate multiple reasons for how the virus could've spread between animals that weren't in direct contact. There's a basic scientific principle that is taught in high school: you don't take the speculation that emerges from a single experiment as fact. Yes the virus may potentially be spread without direct physical contact, but that doesn't make it "airborne".

Some pathogens are very highly infections, some are extremely lethal. The problem with Ebola doesn't stem from its infectiousness, it's mostly due to its high mortality rate...higher than 50%. Compare that to SARS, a highly infections virus, which killed 10% of infected people.

The moron also mucks about the fact that the current strain "is not Ebola Zaire" and that this is a new strain..so the genius concludes the following:

"Note that there doesn't yet seem to be a consensus as to what this new strain is called. One study referred to it as "Guinean EBOV", another as "Guinea 2014 EBOV Ebolavirus" and others are still referring to it as Zaire."

Here's the kicker fellows: viruses evolve very quickly and are named arbitrarily by the scientists who map a particular virus's genetic code. He takes something that's normal and makes it sound like something aweful and unprecedented has occurred.

This is how conspiracy theorists milk both sides of the medical equation. They spread hysteria and belittle the work of scientists, doctors and front-line workers who are working to fight this outbreak AND fault the system and corporations for "not telling you" what's going on. But when we do find vaccines and cures that work, the same conspiracy theorists spread hysteria about vaccines and other treatment.

Read into the resurgence of polio in several developing countries and of pertussis (whooping cough) in places like Australia.

**hasanhh** · August 6, 2014

(salam)

CBC (Canada) "Ebola Outbreak: How Canada's prep has 'led the World' "

One of the section titles is "ebola not easily spread"

Uhh, well I wonder. Starts in Guinea, spreads to Sierra Leone and Liberia in 3-4 months, now 5 dead in Nigeria and may have landed in London...all since the first reported case in February.

If panic starts, people will start to act like during the Yellow Fever epidemic in the US...back then, blocking trains, closing roads, shooting 'strangers', etc.

**David66** · August 6, 2014

^Hello,

Yep! Here in the United States, if any strangers show up in town with a fever we shoot 'em. Then, we pay "illegal immigrants" 50 cents to dispose of the body. That is just how it works in the United States. As all the United States experts on Shia Chat such as Hasanhh can tell you. :)

All the Best,

David

**hasanhh** · August 7, 2014

(salam)

Doing some reading, and being that CDC hasn't released anything but a PR packet on its website, I've been doing some online read. What I found covered the dates 1999-2013.

One study said the mosquitoe Aedes Aegypti does carry Ebola (date is 1999 I think). So, looking up the mosquitoe, I found that is now spread World-Wide. In the US, a map on Aegypti distribution shows: from Cape Hattaras NC and 50 miles inland, then follow the coast down to the 34th Parallel (staying about 50 miles inland), then go west through Columbia, SC -south of Little Rock,AR to the Dallas, TX area, then drop south to the Mexican border.

This mosquitoe ranges in this area.

During the 1980s, I remember that a mosquitoe that carried malaria was blown by the weather into Indiana but could not survive the local Winter. Which mosquitoe I do not know.

**Contrary to this: on TV news reports, the interviewed people said mosquitoes do not carry the virus.

Other carriers/reservoirs I found are: pigs for Ebola Reston in the Phillippines, dogs and bats --which are 'unaffected'-- for Ebola Zaire.

One report said that 173 possible carriers/reservoirs with 40,000+ specimens had "all negative results'. I didn't see bed bugs listed.

As "iffy" as info appears to be, temporarily bringing back DDT is a very good idea.

Deewan · August 7, 2014

Where exactly are you performing your research? Do you know why DDT was banned?

**hasanhh** · August 7, 2014

(salam)

Deewan: I read stuff that would have some credibility, like .edu and .gov

News articles and blogs I usually avoid with this subject.

As to DDT, that ban circa 1970 was to protect eagle eggs since their shells were too thin from DDT exposure. So a 1 or 2 year lifting of the ban to protect people will not adversely affect eagles --and there are not that many in the southern US in the geographic area delineated above.

Also, above you mentioned that names are sometimes given arbitrarily. One thing I read was a paragraph on how and when the name "Ebola Zaire" was changed over the years since ~1976.

Edited August 7, 2014 by hasanhh

**hasanhh** · August 8, 2014

(salam)

Some things from the papers:

"Ebola risk unheeded as Guinea's villagers keep on eating fruit bats", the guardian.com, Monday 04Aug14

--the title encapsulates most of the article. Bats carry the disease.

--supplementarily, Tom Frieden, Director, CDC on BBC News 07Aug14, 1800hrs EDT said the same about the bats

"People are struggling taking..." Washington Post, 07Aug14

--mostly about the problems the health professionals are having

"The Most Disturbing Myths about Ebola Virus Debunked", Huffington Post, 07Aug14, by Anna Almendraia

--as most of the readers commented, this is a junk article

--the only interesting thing was that Medicines sans Frontieres were the health workers who were blamed for allegedly bringing in Ebola into the villages.

kbsquare · August 9, 2014

Yes. I really was of the impression that Ebola was airborne.

(salam)

Bodily fluid exchange only.

(wasalam)

**hasanhh** · August 9, 2014

Bat fluids.

Mosquiitoe fluids.

Bush meat fluids.

One edu/gov article said 'dog fluids'.

Edited August 9, 2014 by hasanhh

IbnSohan · August 9, 2014

http://www.nature.com/srep/2012/121115/srep00811/full/srep00811.html

SCIENTIFIC REPORTS | ARTICLE OPEN

Print
Email
Share/bookmark

Transmission of Ebola virus from pigs to non-human primates

Scientific Reports 2, Article number: 811 doi:10.1038/srep00811 Received 25 April 2012 Accepted 28 September 2012 Published 15 November 2012

Article tools

Ebola viruses (EBOV) cause often fatal hemorrhagic fever in several species of simian primates including human. While fruit bats are considered natural reservoir, involvement of other species in EBOV transmission is unclear. In 2009, Reston-EBOV was the first EBOV detected in swine with indicated transmission to humans. In-contact transmission of Zaire-EBOV (ZEBOV) between pigs was demonstrated experimentally. Here we show ZEBOV transmission from pigs to cynomolgus macaques without direct contact. Interestingly, transmission between macaques in similar housing conditions was never observed. Piglets inoculated oro-nasally with ZEBOV were transferred to the room housing macaques in an open inaccessible cage system. All macaques became infected. Infectious virus was detected in oro-nasal swabs of piglets, and in blood, swabs, and tissues of macaques. This is the first report of experimental interspecies virus transmission, with the macaques also used as a human surrogate. Our finding may influence prevention and control measures during EBOV outbreaks.

Subject terms:

At a glance

Figures

First | 1-2 of 2 | Last

View all figures

left

Figure 1
Figure 2

right

Introduction

Ebola viruses belong to the family Filoviridae, genus Ebolavirus. Those endemic to Africa cause severe hemorrhagic fever with frequent fatal outcome in humans, great apes and several species of non-human primates (NHPs). Fruit bats are considered to be the natural reservoir for EBOV in Africa¹. In 2009, the only non-African known species of EBOV, Reston Ebola virus (REBOV), was isolated from swine in Philippines, with antibodies against the virus detected in pig farmers^2, 3. However REBOV did not cause clinical signs in experimentally inoculated pigs⁴. In contrast to African species of EBOV, REBOV does not cause clinical symptoms in humans, although the infection may be fatal in cynomolgus macaques⁵. We have previously demonstrated that Zaire-EBOV (ZEBOV) can infect pigs, cause disease, and transmit to in-contact pigs⁶. While primates develop systemic infection associated with immune dysregulation resulting in severe hemorrhagic fever, the EBOV infection in swine affects mainly respiratory tract, implicating a potential for airborne transmission of ZEBOV^2, 6. Contact exposure is considered to be the most important route of infection with EBOV in primates⁷, although there are reports suggesting or suspecting aerosol transmission of EBOV from NHP to NHP^8, 9, 10, or in humans based on epidemiological observations¹¹. The present study was design to evaluate EBOV transmission from experimentally infected piglets to NHPs without direct contact.

Results

Six four-week old Landrace piglets (Sus scrofa) were oronasally inoculated with 10⁶ TCID50 of ZEBOV (Kikwit 95) per animal. The piglets were transferred to a separate room for the inoculations, and then moved back into the room containing four cynomolgus macaques. This age group was selected based on the previous observation of differences in severity of the disease in ZEBOV inoculated piglets⁶ to ensure sufficient survival time of the piglets potentially needed for virus transmission, and to determine whether piglets without an overt clinical disease could transmit the virus. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 20 cm in front of the bottom cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 10 cm above the ground, top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP cages were located immediately to the side of the air exhaust system. The cubicle layout respective to the airflow (ten complete air exchanges per hour) in the room is schematically indicated in Supplemental Figure S1. During the husbandry, piglets were moved away from the cages and enclosed by the gate system. The floor was washed, taking care that the water is sprayed at low pressure and away from the NHP cages, to avoid any splashes into the bottom cages. Also the 20 cm space between the wire barrier and the cages was cleaned separately with running water prior to proceeding with NHP cage cleaning. Both animal species were fed after the cleaning, providing new clean dishes for the macaques, with staff changing disposable outer gloves between procedures and animals. The design and size of the animal cubicle did not allow to distinguish whether the transmission was by aerosol, small or large droplets in the air, or droplets created during floor cleaning which landed inside the NHP cages (fomites). The husbandry flow during the sampling days was: cleaning, followed by sampling, then feeding, with staff changing disposable outer gloves between procedures and animals. Pigs and NHPs were sampled on alternative days except for day 3 post infection, when NHPs were sampled in the morning and the piglets in the afternoon.

Clinical signs and gross pathology in swine, following the inoculation with EBOV, were comparable to previous infection study in piglets of this age group⁶. Increase in respiratory rate (up to 80 breaths/min) and in rectal temperatures (40.2–40.5°C) was observed between 5 and 7 days post infection (dpi). All piglets apparently recovered from the disease by 9 dpi. Piglets Nos. 1, 2 and 4 were euthanized at 12 dpi, and piglets Nos. 3, 5 and 6 at 14 dpi, based on experimental schedule. Clinical scores and parameters are provided in the Supplementary Information (Supplemental Figure 2A, Supplemental Table 1). No significant lesions were observed at the necropsy. Microscopic lung lesions were focal and not extensive, characterized by broncho-interstitial pneumonia with a lobular pattern, similar to those described in our previous report⁶. Virus antigen was detected by immunohistochemistry in three piglets (No. 2, 4, and week signal in No. 5), primarily within the areas of necrosis often adjacent to bronchioles (Supplemental Figure S3A). The presence of virus in the lung was confirmed by detection of EBOV RNA employing real-time RT-PCR targeting the L gene, and by virus isolation on Vero E6 cells for piglet No. 2 and No. 4. Virus isolation was also attempted from lung associated lymph nodes, based on detection of viral RNA, yielding one, successful isolation. Viral RNA was detected in submandibular lymph nodes of all piglets, and in the spleen and liver of two piglets. Low level of viremia based on RNA levels was detected in blood of four piglets at 5 and 7 dpi. EBOV RNA was detected in nasal and oral swabs of piglets from 1 dpi until 7 dpi, inclusively (Figure 1A), and from rectal swabs on day 1 and 5, but not at 3, 7 and 12 dpi (Supplemental Table 1). Viral isolation was attempted on all swabs. Out of 45 oral and nasal swabs positive by RT-PCR, 16 were positive on virus isolation, while two out of 11 RNA-positive rectal swabs tested positive for virus. Presence of EBOV RNA in cell culture supernatants from the isolates with observed CPE was confirmed by real time RT-PCR (Supplemental Table 1; Supplemental Table 2).

Figure 1: Detection of EBOV RNA in swabs and blood.

(A) Shedding in pigs. Squares represent the oral swabs and triangles illustrate the nasal swabs. Gray line with diamonds shows the general trend of the oro-nasal shedding. (B) Non-human primates: square markers represent the oral swabs, diamonds represent the rectal swabs, triangles represent the nasal swabs, circles represent blood samples. Gray markers-NHP No. 51M and 20F, black markers-NHP 07M and 34F. “dpi” (days post inoculation) and “dpe” (days post exposure) on the X axis are equivalent.

Full size image (109 KB)

Air sampling was conducted on day 0, 3, 6, 8 and 11 post inoculation. Real time RT-PCR targeting the L gene detected viral RNA on days 6 and 8 post inoculation. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates following husbandry, during the NHP sampling. Average values of 4.4 log10 copies/ml and 3.85 log10 copies/ml of the sampling buffer were detected at 6 and 8 dpi, respectively. Virus isolations were not successful, likely due to the sampling buffer composition (0.1% Tween 20).

All four NHPs (Macaca fascularis) were alert and in good apparent health until 7 days post exposure (dpe - corresponding to dpi of piglets) with ZEBOV. At 8 dpe, macaques 07M (bottom left cage) and 34F (upper right cage), housed in cages located within an air flow towards the exhaust system, were euthanized based on clinical signs typical for EBOV infection in NHPs. Both had petechial hemorrhages on the skin of the chest and along internal surfaces of the arms and legs. Macaques 51M and 20F were visually healthy until 12 dpe, when early clinical signs were noted, and both animals were euthanized the next day (13 dpe). The NHPs were euthanized when convincing clinical signs typical for EBOV infection became apparent, preferably prior to the humane endpoint (Supplemental Figure S2B; Supplemental Table 1). Examination of internal organs at the necropsy exposed damages mainly to the lung (Supplemental Figure S4) and liver. Microscopic lesions and antigen distribution in the organs were similar to previous reports^12, 13, 14, except for the lesions and antigen distribution in lungs. Interstitial pneumonia was characterized by thickened and hypercellular alveolar septa due to infiltration by primarily macrophages (Supplemental Fig. 3B), with multifocal areas of alveolar hemorrhage and edema. EBOV antigen was detected extensively in alveolar and septal macrophages using double immunostaining (Supplemental Fig. 3C), as well as within pneumocytes and endothelial cells. Viral antigen was also observed within bronchiolar epithelial cells with adjacent segmental loss of epithelial cells (Figure 2.) and within respiratory epithelial cells of the trachea. The pattern of lesions and immunostaining for EBOV antigen in lungs suggests infection of the lungs both, via respiratory epithelium and due to viremic spread of the virus.

Figure 2: Lungs, macaque No.34F.

Segmental attenuation and loss of respiratory epithelium in the bronchiolar wall (large arrow) with some areas of the lungs relatively unaffected (arrowhead). Immunostaining for Ebola virus antigen was detected in occasional respiratory epithelial cells (small arrow) as well as within alveolar and septal macrophages. Bar = 50 μm.

Full size image (496 KB)

There was a remarkable difference in the type and quantity of cells infiltrating the lungs between the macaques and the pigs, although viral antigen was detected only in alveolar macrophages of both species. Monocytes/macrophages were essentially the only leukocyte type infiltrating the lungs in non-human primates, while large quantities of non-infected lymphocytes were recruited into the pig lungs. This phenomenon can be linked to different clinical picture in the two animal species: respiratory distress in pigs (severe in a specific age group⁶) versus systemic disease with no major respiratory signs in NHPs. It will be important to identify differences and similarities in ZEBOV-induced pathogenesis and pathology between the two species in future studies.

Infection of the NHPs with ZEBOV was confirmed by detection of viral RNA (real time RT-PCR targeting the L gene), and in all samples collected at euthanasia by virus isolation. The first detection of ZEBOV RNA was in the blood of NHPs 34F and 07M at 6 dpe, with virus isolation from macaque 07M. This was followed by ZEBOV RNA detection in nasal, oral and rectal swabs from the same NHPs at 8 dpe (Figure 1B). A similar pattern was observed for macaques 51M and 20F, starting at 11 dpe with detection of RNA in blood and virus isolation from animal 20F, followed by RNA and virus detection in swabs at 13 dpi. Detection of viral RNA and infectious virus in blood, swabs and tissues of the macaques (summarized in Supplemental Table 4) confirmed systemic spread of the virus. Whole genome sequencing performed on virus nucleic acid from selected swab and lung samples from pigs and NHPs confirmed identity of the virus.

Discussion

Pigs were the source of ZEBOV at a time of infection of NHPs euthanized at 8 dpe (07M and 34F) since shedding from the macaques was not detected at dpe 3 or 6. NHPs euthanized at 13 dpe (20F, 51M) could have contracted ZEBOV from the environment contaminated by either species, considering previous reports on development of disease following aerosol exposure¹⁰, or other inoculation routes^5, 15, 16, although pigs can generate infectious short range large aerosol droplets more efficiently then other species¹⁷. We have also never observed transmission of EBOV from infected to naive macaques, including in an experiment employing the same cage setting as in the current study, where three NHPs intramuscularly inoculated with EBOV did not transmit the virus to one naive NHP for 28 days, the duration of the protocol. During another study, three EBOV infected NHPs cohabiting with 10 naive NHPs in adjacent cage systems did not transmit the virus to naive animals for 28 days (unpublished data). The exact route of infection of the NHPs is impossible to discern with certitude because they were euthanized at a time when EBOV had already spread systemically. However, the segmental attenuation and loss of bronchiolar epithelium and the presence of Ebola virus antigen in some of the respiratory epithelial cells in the lungs of all macaques suggest that the airways were one of the routes involved in the acquisition of infection, consistent with previous reports^9, 10. Other routes of inoculation generally did not lead to lesions in the respiratory tract comparable to those observed in this study^12, 13.

Under conditions of the current study, transmission of ZEBOV could have occurred either by inhalation (of aerosol or larger droplets), and/or droplet inoculation of eyes and mucosal surfaces and/or by fomites due to droplets generated during the cleaning of the room. Infection of all four macaques in an environment, preventing direct contact between the two species and between the macaques themselves, supports the concept of airborne transmission.

It is of interest, that the first macaques to become infected were housed in cages located directly within the main airflow to the air exhaust system. The experimental setting of the present study could not quantify the relative contribution of aerosol, small and large droplets in the air, and droplets landing inside the NHP cages (fomites) to EBOV transmission between pigs and macaques. These parameters will need to be investigated using an experimental approach specifically designed to address this question.

The present study provides evidence that infected pigs can efficiently transmit ZEBOV to NHPs in conditions resembling farm setting. Our findings support the hypothesis that airborne transmission may contribute to ZEBOV spread, specifically from pigs to primates, and may need to be considered in assessing transmission from animals to humans in general. The present experimental findings would explain REBOV seropositivity of pig farmers in Philippines^2, 3 that were not involved in slaughtering or had no known contact with contaminated pig tissues. The results of this study also raise a possibility that wild or domestic pigs may be a natural (non-reservoir) host for EBOV participating in the EBOV transmission to other species in sub-Saharan Africa.

Methods

Virus

ZEBOV strain Kikwit 95 was produced on VERO E6 cells in minimal essential medium (MEM) supplemented with 2% fetal bovine serum and antibiotics (Penicillin/Streptomycin). Virus titers were determined by standard TCID50 and/or immunoplaque assays on VERO E6 cells. Procedures for the production and propagation of ZEBOV and all subsequent experiments involving infectious materials were performed in the Containment Level (CL) 4 facilities of the Canadian Science Center for Human and Animal Health (CSCHAH).

Animal experiments

Four cynomolgus macaques were acclimatized in the BSL4 animal facility for two weeks, and housed in the same room for one week prior to the swine inoculation. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 15 cm in front of the cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 20cm above the ground, while top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP were sampled at 3 and 6 dpi (nasal, oral rectal swabs, blood) as per experimental schedule. Two macaques were euthanized for humane reasons at 8 days post exposure (dpe), and all animals were sampled at that time. Two remaining NHPs were in addition sampled at 11 dpe, and at13 dpe when they were euthanized. The animals were euthanized when typical clinical signs of Ebola infection became apparent, if possible prior to reaching the humane endpoint. Lung, lung associated lymph nodes, liver, spleen and intestine were collected at the necropsy.

Pigs (breed Landrace) were obtained from a high health status herd operated by a recognized commercial supplier in Manitoba, Canada. Three-week old piglets, designated as animal No. 1–6, were acclimatized for seven days prior to the inoculation in an animal cubicle already housing the non-human primates. The six piglets were inoculated oro-nasally with 2 ml of 10⁶ TCID50 total per animal (0.5 ml per each nostril and 1 ml orally) in a room adjacent to the BSL4 animal cubicle and subsequently housed in proximity to cages with four non-human primates (NHP). Swine rectal temperatures were taken during the sampling performed under anesthesia on days 0, 1, 3, 5, 7, 12 and 14, when blood and rectal, oral and nasal swabs were collected. Three piglets were euthanized on day 12 post inoculation (no. 1M, 2M. 4F), and three on day 14 (3M, 5F, 6F), as per experimental schedule. Muscle, lung, liver, spleen, trachea, and submandibular, lung associated and mesenteric lymph nodes were collected at necropsy.

All animal manipulations were performed under CL4 conditions and followed Animal Use Document No. CSCHAH AUD# C-11-004 approved by the Animal Care Committee of the Canadian Science Centre for Human and Animal Health, according to and following the guidelines of the Canadian Council on Animal Care.

Virus isolation

Swabs collected into 1 ml of cMEM, blood, and tissues homogenized in MEM using a bead mill homogenizer according to the manufacturer's protocol (Tissue Lyser, Qiagen) were used for virus isolation and real time RT-PCR analysis. All NHP samples and swine rectal swabs were plated in 10-fold serial dilutions of supernatant on Vero E6 cells with six replicates per dilution. At 72–96 h post-infection the plates were scored for cytopathic effect (CPE) and TCID50 virus titers were calculated using the Reed and Muench method. Swine rectal swabs had to be however carried over onto replica plates for three passages prior to reading the CPE. Swine nasal and oral swabs, blood and tissues were first analyzed by real time RT-PCR targeting the ZEBOV L gene, followed by virus isolation on Vero E6 cells in P6 plates on selected samples.

Virus RNA detection

NHP samples: Total RNA was isolated from tissues preserved and homogenized in RNA later employing the RNeasy Mini Kit (QIAGEN). RNA from nasal washes and swabs was isolated using the QIAamp Viral RNA Mini Kit (QIAGEN, GmbH).

Swine samples: RNA was isolated using Tripure Reagent (Roche Applied Science) according to the manufacturer's recommendations from swabs, blood or 10% w/v tissue homogenates in cMEM. One-Step real-time RT-PCR was carried out using following primers and probe:

ZebovForward -CAGCCAGCAATTTCTTCCAT;

ZebovReverse- TTTCGGTTGCTGTTTCTGTG;

ZebovProbe FAM-ATCATTGGCGTACTGGAGGAGCAG-NFQ.

Armoured enterovirus RNA (Asuragen) was used as external extraction/reaction control. Quantitect Reverse Transcriptase Real-time PCR kit (Qiagen) was employed for the PCR reactions according to the manufacturer's specifications. Reaction conditions for the RT-PCR were as follows: 50°C for 30 minutes; 95°C for 15 minutes; 45 cycles of 95°C for 15 seconds followed by 60°C for 45 seconds. The samples were run on the Rotor-Gene 6000 (Qiagen) or on the the LightCycler 480 (Roche Applied Science). Copy numbers were determined based on the L-gene Ebola plasmid standard control curve. Cut off value for samples to be considered positive were 3 log10 copies/ml (Rotorgene) or 3.15 log10 copies/ml (LightCycler 480).

Air sampling

The air was sampled using BioCapture 650 Air Sampler (FLIR, Arlington, VA) on days 0, 3, 6, 8 and 11 post inoculation of the piglets. The air sampling started after husbandry, concurrent to NHP sampling, later in the morning before noon. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates. The collection took place over a span of about two hours in total (three 30 min collection times with changes of cartridges in between). The air sampler device collects particles by bubbling the air through a pre-loaded buffer (0.74% Tris/0.1 Tween 20) provided in a sealed cartridge by the manufacturer. This solution is not optimal for recovery of live enveloped viruses, and virus isolation attempts were unsuccessful. ZEBOV RNA was detected by real time RT-PCR targeting the L gene.

EBOV sequencing

Viral RNA previously extracted for real time PCR was sequenced by first generating cDNA with the use of Omniscript reverse transcriptase (Qiagen) and random hexamers along with specific EBOV primers followed by PCR with iProof high fidelity DNA polymerase (Bio-Rad) with specific primers (available upon request). DNA sequencing was carried out using the 3730xl DNA Analyzer (ABI).

Histology and immunohistochemistry

Tissues were fixed in 10% neutral phosphate buffered formalin, paraffin embedded using standard procedures, sectioned at 5 m, and stained with hematoxylin and eosin (HE) for histopathologic examination. Detection of viral antigen was performed using A 1:2000 dilution of rabbit polyclonal anti-ZEBOV VP40 antibody as described previously⁶. Identification of macrophages in the lungs was performed by immunostaining for the macrophage/monocyte marker L1 using Clone Mac387 (Dako, USA) primary antibodies. The tissue sections were quenched for 10 minutes in aqueous 3% hydrogen peroxide, prior to retrieval of epitopes using high pH AR10 (BioGenex, CA) in a BioCare Medical Decloaking Chamber. Antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes, and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. For the Mac387/Ebola double stain, antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using a multilink horseradish peroxidase labeled kit, Super Sensitive Link-Label IHC Detection System (BioGenex, CA), reacted with the chromogen diaminobenzidine (DAB). The sections were then incubated with a denaturing solution (1 part A, 3 parts B, BioCare Medical, CA) for 5 minutes, pretreated with proteinase K enzyme for 10 minutes, and rabit polyclonal anti-Ebola Zaire VP40 antibody was applied to the sections at a 1:2,000 dilution for one hour. The anti-EBOV antibody was visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. All sections are counterstained with Gill's hematoxylin.

References

Leroy, E. M. et al. Fruit bats as reservoirs of Ebola virus. Nature 438, 575–576 (2005).
- Show context
Barette, R. W. et al. Discovery of swine as a host for the Reston ebolavirus. Science 325, 204–206 (2009).
- Show context
WHO,. Ebola Reston in pigs. and humans,. Philippines. Weekly Epidemiological Record 7, 47–50 (2009).
- Show context
Marsh, G. A. et al. Ebola Reston virus infection in pigs: clinical significance and transmission potential. J. Infect. Dis. 204 (Suppl.3), S804–S809 (2011).
- Show context
Jahrling, P. B. et al. Experimental infection of cynomolgus macaques with Ebola-Reston filoviruses from the 1989–1990 U.S. epizootic. Arch Virol Suppl 11, 115–134 (1996).
- Show context
Kobinger, G. P. et al. Replication, pathogenicity, shedding, and transmission of Zaire ebolavirus in pigs. J. Infect. Dis. 204, 200–208 (2011).
- Show context
Feldmann, H. & Geisbert, T. W. Ebola haemorrhagic fever. The Lancet 377, 849–862 (2011).
- Show context
Dalgard, D. W. et al. Combined simian hemorrhagic fever and Ebola virus infection in cynomolgus monkeys. Lab Anim. Sci. 42, 152–157 (1992).
- Show context
Jaax, N. et al. Transmission of Ebola virus (Zaire strain) to uninfected control monkeys in a biocontainment laboratory. The Lancet 346, 1669–1671 (1995).
- Show context
Johnson, E., Jaax, N., White, J. & Jahrling, P. Lethal experimental infections of rhesus monkeys by aerosolized Ebola virus. Int. J. Exp. Path. 76, 227–236 (1995).
- Show context
Roels, T. H. et al. Ebola hemorrhagic fever, Kikwit, Democratic Republic of the Congo (1995: Risk factors for patients without a reported exposure. J. Infect. Dis. 179 (Suppl.1), S92- S97 (1999).
- Show context
Baskerville, A., Bowen, E. T., Platt, G. S., McArdell, L. B. & Simpson, D. I. The pathology of experimental Ebola virus infection in monkeys. J. Pathol. 125, 131–138 (1978).
- Show context
Jaax, N. K. et al. Lethal experimental infection of rhesus monkeys with Ebola-Zaire (Mayinga) virus by the oral and conjunctival route of exposure. Arch. Pathol. Lab. Med. 120, 140–55 (1996).
- Show context
Larsen, T. et al. Pathologic findings associated with delayed death in nonhuman primates experimentally infected with Zaire Ebola virus. J. Infect. Dis. 196 Suppl 2, S323–S328 (2007).
- Show context
Geisbert, T. W. et al. Vesicular stomatitis virus-based vaccines protect nonhuman primates against aerosol challenge with Ebola and Marburg viruses. Vaccine 26, 6894–6900 (2008).
- Show context
Geisbert, T. W. et al. Postexposure protection of non-human primates against a lethal Ebola virus challenge with RNA interference: a proof-of-concept study. Lancet 375, 1896-905 (2010).
- Show context
Donaldson, A. I. & Alexandersen S. Predicting the spread of foot and mouth disease by airborne virus. Rev Sci Tech OIE 21, 569–575 (2002).
- Show context

Download references

Acknowledgements

We would like to thank Dr. Melanie van der Loop, Kevin Tierney, and Gary Wong for the assistance with animal care, to Peter Marszal, Jill Graham and Brad Collignon for the technical assistance, and to Dr. Soren Alexandersen for the critical review of the manuscript. The project was supported by CFIA and PHAC, with funding provided from the CRTI Cluster Activity fund CRTI-3780-2011-30va-17.

Author information

Affiliations

National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, 1015 Arlington St. Winnipeg, Manitoba, R3E 3M4, Canada
- Hana M. Weingartl,
- Carissa Embury-Hyatt,
- Charles Nfon &
- Greg Smith
Department of Medical Microbiology, University of Manitoba, Winnipeg, Canada
- Hana M. Weingartl &
- Gary Kobinger
National Microbiology Laboratory, Public Health Agency of Canada, 1015 Arlington St., Winnipeg, Manitoba, R3E 3R2, Canada
- Anders Leung &
- Gary Kobinger

Contributions

H.M.W. and G.K. conceived the study, design experiments, performed the animal experiments, analyzed and interpreted data, and wrote the manuscript. C.E-H. provided analysis of histopathology and data interpretation; A.L., G.S. and C.N. performed in vitro experiments and analyzed related data.

Competing financial interests

The authors declare no competing financial interests.

Corresponding authors

Correspondence to:

Supplementary information

Introduction•
Results•
Discussion•
Methods•
References•
Acknowledgements•
Author information•
Supplementary information•
Comments

PDF files

Supplementary Information (388K)
Supplementary Information

**hasanhh** · August 9, 2014

Thanks IbnSohan,

Things I found this morning:

Above at post #19, I cited the mosquitoe Aedes Agypti. This page and ones at "Health Desk" and all have been taken down. These pages came listed under mosquitoe transmission of ebola.

A 1995 study/report -WHO I think it was- cited collecting 34,000+samples and found nothing but one instance of Bunya. Another article citing negative results that I read before is still up.

However, if mosquitoes were not a problem -which doesn't explain why the WHO has declare a Global Health Emergency- there is the news article:

Nigerian Tribune, Friday, 08Aug14, "Latest on Ebola". At the end of the article, Governor R.Yero of Kaduna State says 69,000 impregnated mosquitoe nets have been brought into Kaduna, along with refrigeration and solar power.

A brief statement on Ebola is at:

"Are Insects Ebola's Natural Host/Resevoir?", web.stanford.edu/group/virus/filo/insects.html

Bats as Ebola resevoirs is at:

"Infection Mechanism of Genus Ebolavirus" , microbewiki.Kenyon.edu

A Map of where these three species of fruit bats are can be found at:

"Geographic Distribution of Ebola Disease Outbreaks in Humans and Animals" www.who.int/csr/disease/ebola/geographic-ebola.jpg

What I think is, Ebola is transmitted by mosquitoes, this is why WHO declared "global emergency", and gov'ts are not admitting this "to avoid panic" rather than get on with public awareness and prevention. Why else mosquitoe nets?

A couple of edu/gov articles say that the incubation period for Ebola is "2-21 days". Without closing off infected areas and interim quarantine before traveling to other countries or returning to the USA, then it appears plausible that a returnee from West Africa could be infected, get bitten by a mosquitoe in the US and start the spread here.

Info on airborne transmission is also mixed. But I have to ask the question: "If not, then why is Ebola ranked as a Category 1 bio-weapon?"

Deewan · August 9, 2014

^Your medical expertise is humbling. Did you pay any attention to what I said?

IbnSohan · August 9, 2014

Thanks IbnSohan,

Things I found this morning:

Above at post #19, I cited the mosquitoe Aedes Agypti. This page and ones at "Health Desk" and all have been taken down. These pages came listed under mosquitoe transmission of ebola.

A 1995 study/report -WHO I think it was- cited collecting 34,000+samples and found nothing but one instance of Bunya. Another article citing negative results that I read before is still up.

However, if mosquitoes were not a problem -which doesn't explain why the WHO has declare a Global Health Emergency- there is the news article:

Nigerian Tribune, Friday, 08Aug14, "Latest on Ebola". At the end of the article, Governor R.Yero of Kaduna State says 69,000 impregnated mosquitoe nets have been brought into Kaduna, along with refrigeration and solar power.

A brief statement on Ebola is at:
"Are Insects Ebola's Natural Host/Resevoir?", web.stanford.edu/group/virus/filo/insects.html

Bats as Ebola resevoirs is at:
"Infection Mechanism of Genus Ebolavirus" , microbewiki.Kenyon.edu

A Map of where these three species of fruit bats are can be found at:
"Geographic Distribution of Ebola Disease Outbreaks in Humans and Animals" www.who.int/csr/disease/ebola/geographic-ebola.jpg

What I think is, Ebola is transmitted by mosquitoes, this is why WHO declared "global emergency", and gov'ts are not admitting this "to avoid panic" rather than get on with public awareness and prevention. Why else mosquitoe nets?

A couple of edu/gov articles say that the incubation period for Ebola is "2-21 days". Without closing off infected areas and interim quarantine before traveling to other countries or returning to the USA, then it appears plausible that a returnee from West Africa could be infected, get bitten by a mosquitoe in the US and start the spread here.

Info on airborne transmission is also mixed. But I have to ask the question: "If not, then why is Ebola ranked as a Category 1 bio-weapon?"

You are welcome. You are correct, the airborne rout is not confirmed but highly suspected as outlined by the canadian public health site

MODE OF TRANSMISSION: In an outbreak, it is hypothesized that the first patient becomes infected as a result of contact with an infected animal ⁽¹⁵⁾. Person-to-person transmission occurs via close personal contact with an infected individual or their body fluids during the late stages of infection or after death ^{(1, 2, 15, 27)}. Nosocomial infections can occur through contact with infected body fluids due to the reuse of unsterilized syringes, needles, or other medical equipment contaminated with these fluids ^(1, 2). Humans may be infected by handling sick or dead non-human primates and are also at risk when handling the bodies of deceased humans in preparation for funerals, suggesting possible transmission through aerosol droplets ^(2, 6, 28). In the laboratory, infection through small-particle aerosols has been demonstrated in primates, and airborne spread among humans is strongly suspected, although it has not yet been conclusively demonstrated ^(1, 6, 13). The importance of this route of transmission is not clear. Poor hygienic conditions can aid the spread of the virus ⁽⁶⁾.

http://www.phac-aspc.gc.ca/lab-bio/res/psds-ftss/ebola-eng.php

**hasanhh** · August 9, 2014

In addition to your "mode" post, one article I read again today said touching the walls or the sides of tents transmit this disease.

So, unlike AIDS (time unknown) or Herpes (about 5 minutes), Ebola apparently remains virulent without a host for some unknown period of time.

Constructive criticism is always good, but I am starting to wonder if Deewan and others are ostriches.

(Rather than face fear, sticks its head in the sand.)

Edited August 9, 2014 by hasanhh

blu115 · August 9, 2014

blu115: I read that back in 1999. Good book. Remember how the Army tried to keep things secret during the Ebola Reston outbreak??

Yea, I thought it would lead to a major disaster, especially when one of the army col.'s there might have been infected when a monkey handler ran out and panicked. It piqued my interest that something big and bad would happen but nah.

**hasanhh** · August 9, 2014

blu115:

I have been doing more online today. Nothing really new to what we have above.

One site mention birds as a possible carrier.

Another site was explaining that Ebola may not be able to "replicate" inside some mosquitoes, so those mosquitoes will not carry the disease like they do with Family Flaviviridae.

Ebola and Marberg are Family Filovirdae.

So maybe there is some good news. Ticks, though, were listed as a probable carrier.

One of the things I remember about "Hot Zone" is their going down to the stores to by chlorine to disinfect the place in Reston. Until reading this week, I didn't know Ebola-Reston was traced back to the pigs in the Phillippines, and the pig farmers have anti-bodies for this.

Forgot:

If you want a compendium of sources, go to Filovir.com

Edited August 9, 2014 by hasanhh

Sign In

Ebola [OFFICIAL THREAD]

Recommended Posts

Top Posters In This Topic

Popular Days

Top Posters In This Topic

Popular Days

Popular Posts

Deewan

Haydar Husayn

Little_Socrates

Posted Images

Join the conversation

Recently Browsing 0 members

Topics