Jump to content
hasanhh

Ebola [OFFICIAL THREAD]

Recommended Posts

(salam)

 

Deewan:  I read stuff that would have some credibility, like .edu and .gov

 

News articles and blogs I usually avoid with this subject.

 

 

As to DDT, that ban circa 1970 was to protect eagle eggs since their shells were too thin from DDT exposure. So a 1 or 2 year lifting of the ban to protect people will not adversely affect eagles --and there are not that many in the southern US in the geographic area delineated above.

 

 

Also, above you mentioned that names are sometimes given arbitrarily. One thing I read was a paragraph on how and when the name "Ebola Zaire" was changed over the years since ~1976.

Edited by hasanhh

Share this post


Link to post
Share on other sites

(salam)

 

Some things from the papers:

 

"Ebola risk unheeded as Guinea's villagers keep on eating fruit bats", the guardian.com, Monday 04Aug14

--the title encapsulates most of the article. Bats carry the disease.

--supplementarily, Tom Frieden, Director, CDC on BBC News 07Aug14, 1800hrs EDT said the same about the bats

 

"People are struggling taking..." Washington Post, 07Aug14

--mostly about the problems the health professionals are having

 

"The Most Disturbing Myths about Ebola Virus Debunked", Huffington Post, 07Aug14, by Anna Almendraia

--as most of the readers commented, this is a junk article

--the only interesting thing was that Medicines sans Frontieres were the health workers who were blamed for allegedly bringing in Ebola into the villages.

Share this post


Link to post
Share on other sites

http://www.nature.com/srep/2012/121115/srep00811/full/srep00811.html

SCIENTIFIC REPORTS | ARTICLE OPEN

Transmission of Ebola virus from pigs to non-human primates Scientific Reports   2,   Article number:   811   doi:10.1038/srep00811 Received   25 April 2012  Accepted   28 September 2012  Published   15 November 2012

Ebola viruses (EBOV) cause often fatal hemorrhagic fever in several species of simian primates including human. While fruit bats are considered natural reservoir, involvement of other species in EBOV transmission is unclear. In 2009, Reston-EBOV was the first EBOV detected in swine with indicated transmission to humans. In-contact transmission of Zaire-EBOV (ZEBOV) between pigs was demonstrated experimentally. Here we show ZEBOV transmission from pigs to cynomolgus macaques without direct contact. Interestingly, transmission between macaques in similar housing conditions was never observed. Piglets inoculated oro-nasally with ZEBOV were transferred to the room housing macaques in an open inaccessible cage system. All macaques became infected. Infectious virus was detected in oro-nasal swabs of piglets, and in blood, swabs, and tissues of macaques. This is the first report of experimental interspecies virus transmission, with the macaques also used as a human surrogate. Our finding may influence prevention and control measures during EBOV outbreaks.

At a glance
Figures
First | 1-2 of 2 | Last
View all figures
left
  1. srep00811-f1.jpgFigure 1
  2. srep00811-f2.jpgFigure 2
right
Introduction

Ebola viruses belong to the family Filoviridae, genus Ebolavirus. Those endemic to Africa cause severe hemorrhagic fever with frequent fatal outcome in humans, great apes and several species of non-human primates (NHPs). Fruit bats are considered to be the natural reservoir for EBOV in Africa1. In 2009, the only non-African known species of EBOV, Reston Ebola virus (REBOV), was isolated from swine in Philippines, with antibodies against the virus detected in pig farmers23. However REBOV did not cause clinical signs in experimentally inoculated pigs4. In contrast to African species of EBOV, REBOV does not cause clinical symptoms in humans, although the infection may be fatal in cynomolgus macaques5. We have previously demonstrated that Zaire-EBOV (ZEBOV) can infect pigs, cause disease, and transmit to in-contact pigs6. While primates develop systemic infection associated with immune dysregulation resulting in severe hemorrhagic fever, the EBOV infection in swine affects mainly respiratory tract, implicating a potential for airborne transmission of ZEBOV26. Contact exposure is considered to be the most important route of infection with EBOV in primates7, although there are reports suggesting or suspecting aerosol transmission of EBOV from NHP to NHP8910, or in humans based on epidemiological observations11. The present study was design to evaluate EBOV transmission from experimentally infected piglets to NHPs without direct contact.

Results

Six four-week old Landrace piglets (Sus scrofa) were oronasally inoculated with 106 TCID50 of ZEBOV (Kikwit 95) per animal. The piglets were transferred to a separate room for the inoculations, and then moved back into the room containing four cynomolgus macaques. This age group was selected based on the previous observation of differences in severity of the disease in ZEBOV inoculated piglets6 to ensure sufficient survival time of the piglets potentially needed for virus transmission, and to determine whether piglets without an overt clinical disease could transmit the virus. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 20 cm in front of the bottom cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 10 cm above the ground, top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP cages were located immediately to the side of the air exhaust system. The cubicle layout respective to the airflow (ten complete air exchanges per hour) in the room is schematically indicated in Supplemental Figure S1. During the husbandry, piglets were moved away from the cages and enclosed by the gate system. The floor was washed, taking care that the water is sprayed at low pressure and away from the NHP cages, to avoid any splashes into the bottom cages. Also the 20 cm space between the wire barrier and the cages was cleaned separately with running water prior to proceeding with NHP cage cleaning. Both animal species were fed after the cleaning, providing new clean dishes for the macaques, with staff changing disposable outer gloves between procedures and animals. The design and size of the animal cubicle did not allow to distinguish whether the transmission was by aerosol, small or large droplets in the air, or droplets created during floor cleaning which landed inside the NHP cages (fomites). The husbandry flow during the sampling days was: cleaning, followed by sampling, then feeding, with staff changing disposable outer gloves between procedures and animals. Pigs and NHPs were sampled on alternative days except for day 3 post infection, when NHPs were sampled in the morning and the piglets in the afternoon.

Clinical signs and gross pathology in swine, following the inoculation with EBOV, were comparable to previous infection study in piglets of this age group6. Increase in respiratory rate (up to 80 breaths/min) and in rectal temperatures (40.2–40.5°C) was observed between 5 and 7 days post infection (dpi). All piglets apparently recovered from the disease by 9 dpi. Piglets Nos. 1, 2 and 4 were euthanized at 12 dpi, and piglets Nos. 3, 5 and 6 at 14 dpi, based on experimental schedule. Clinical scores and parameters are provided in the Supplementary Information (Supplemental Figure 2A, Supplemental Table 1). No significant lesions were observed at the necropsy. Microscopic lung lesions were focal and not extensive, characterized by broncho-interstitial pneumonia with a lobular pattern, similar to those described in our previous report6. Virus antigen was detected by immunohistochemistry in three piglets (No. 2, 4, and week signal in No. 5), primarily within the areas of necrosis often adjacent to bronchioles (Supplemental Figure S3A). The presence of virus in the lung was confirmed by detection of EBOV RNA employing real-time RT-PCR targeting the L gene, and by virus isolation on Vero E6 cells for piglet No. 2 and No. 4. Virus isolation was also attempted from lung associated lymph nodes, based on detection of viral RNA, yielding one, successful isolation. Viral RNA was detected in submandibular lymph nodes of all piglets, and in the spleen and liver of two piglets. Low level of viremia based on RNA levels was detected in blood of four piglets at 5 and 7 dpi. EBOV RNA was detected in nasal and oral swabs of piglets from 1 dpi until 7 dpi, inclusively (Figure 1A), and from rectal swabs on day 1 and 5, but not at 3, 7 and 12 dpi (Supplemental Table 1). Viral isolation was attempted on all swabs. Out of 45 oral and nasal swabs positive by RT-PCR, 16 were positive on virus isolation, while two out of 11 RNA-positive rectal swabs tested positive for virus. Presence of EBOV RNA in cell culture supernatants from the isolates with observed CPE was confirmed by real time RT-PCR (Supplemental Table 1; Supplemental Table 2).

Figure 1: Detection of EBOV RNA in swabs and blood.
srep00811-f1.jpg

(A) Shedding in pigs. Squares represent the oral swabs and triangles illustrate the nasal swabs. Gray line with diamonds shows the general trend of the oro-nasal shedding. (B) Non-human primates: square markers represent the oral swabs, diamonds represent the rectal swabs, triangles represent the nasal swabs, circles represent blood samples. Gray markers-NHP No. 51M and 20F, black markers-NHP 07M and 34F. “dpi” (days post inoculation) and “dpe” (days post exposure) on the X axis are equivalent.

Air sampling was conducted on day 0, 3, 6, 8 and 11 post inoculation. Real time RT-PCR targeting the L gene detected viral RNA on days 6 and 8 post inoculation. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates following husbandry, during the NHP sampling. Average values of 4.4 log10 copies/ml and 3.85 log10 copies/ml of the sampling buffer were detected at 6 and 8 dpi, respectively. Virus isolations were not successful, likely due to the sampling buffer composition (0.1% Tween 20).

All four NHPs (Macaca fascularis) were alert and in good apparent health until 7 days post exposure (dpe - corresponding to dpi of piglets) with ZEBOV. At 8 dpe, macaques 07M (bottom left cage) and 34F (upper right cage), housed in cages located within an air flow towards the exhaust system, were euthanized based on clinical signs typical for EBOV infection in NHPs. Both had petechial hemorrhages on the skin of the chest and along internal surfaces of the arms and legs. Macaques 51M and 20F were visually healthy until 12 dpe, when early clinical signs were noted, and both animals were euthanized the next day (13 dpe). The NHPs were euthanized when convincing clinical signs typical for EBOV infection became apparent, preferably prior to the humane endpoint (Supplemental Figure S2B; Supplemental Table 1). Examination of internal organs at the necropsy exposed damages mainly to the lung (Supplemental Figure S4) and liver. Microscopic lesions and antigen distribution in the organs were similar to previous reports121314, except for the lesions and antigen distribution in lungs. Interstitial pneumonia was characterized by thickened and hypercellular alveolar septa due to infiltration by primarily macrophages (Supplemental Fig. 3B), with multifocal areas of alveolar hemorrhage and edema. EBOV antigen was detected extensively in alveolar and septal macrophages using double immunostaining (Supplemental Fig. 3C), as well as within pneumocytes and endothelial cells. Viral antigen was also observed within bronchiolar epithelial cells with adjacent segmental loss of epithelial cells (Figure 2.) and within respiratory epithelial cells of the trachea. The pattern of lesions and immunostaining for EBOV antigen in lungs suggests infection of the lungs both, via respiratory epithelium and due to viremic spread of the virus.

Figure 2: Lungs, macaque No.34F.
srep00811-f2.jpg

Segmental attenuation and loss of respiratory epithelium in the bronchiolar wall (large arrow) with some areas of the lungs relatively unaffected (arrowhead). Immunostaining for Ebola virus antigen was detected in occasional respiratory epithelial cells (small arrow) as well as within alveolar and septal macrophages. Bar = 50 μm.

There was a remarkable difference in the type and quantity of cells infiltrating the lungs between the macaques and the pigs, although viral antigen was detected only in alveolar macrophages of both species. Monocytes/macrophages were essentially the only leukocyte type infiltrating the lungs in non-human primates, while large quantities of non-infected lymphocytes were recruited into the pig lungs. This phenomenon can be linked to different clinical picture in the two animal species: respiratory distress in pigs (severe in a specific age group6) versus systemic disease with no major respiratory signs in NHPs. It will be important to identify differences and similarities in ZEBOV-induced pathogenesis and pathology between the two species in future studies.

Infection of the NHPs with ZEBOV was confirmed by detection of viral RNA (real time RT-PCR targeting the L gene), and in all samples collected at euthanasia by virus isolation. The first detection of ZEBOV RNA was in the blood of NHPs 34F and 07M at 6 dpe, with virus isolation from macaque 07M. This was followed by ZEBOV RNA detection in nasal, oral and rectal swabs from the same NHPs at 8 dpe (Figure 1B). A similar pattern was observed for macaques 51M and 20F, starting at 11 dpe with detection of RNA in blood and virus isolation from animal 20F, followed by RNA and virus detection in swabs at 13 dpi. Detection of viral RNA and infectious virus in blood, swabs and tissues of the macaques (summarized in Supplemental Table 4) confirmed systemic spread of the virus. Whole genome sequencing performed on virus nucleic acid from selected swab and lung samples from pigs and NHPs confirmed identity of the virus.

Discussion

Pigs were the source of ZEBOV at a time of infection of NHPs euthanized at 8 dpe (07M and 34F) since shedding from the macaques was not detected at dpe 3 or 6. NHPs euthanized at 13 dpe (20F, 51M) could have contracted ZEBOV from the environment contaminated by either species, considering previous reports on development of disease following aerosol exposure10, or other inoculation routes51516, although pigs can generate infectious short range large aerosol droplets more efficiently then other species17. We have also never observed transmission of EBOV from infected to naive macaques, including in an experiment employing the same cage setting as in the current study, where three NHPs intramuscularly inoculated with EBOV did not transmit the virus to one naive NHP for 28 days, the duration of the protocol. During another study, three EBOV infected NHPs cohabiting with 10 naive NHPs in adjacent cage systems did not transmit the virus to naive animals for 28 days (unpublished data). The exact route of infection of the NHPs is impossible to discern with certitude because they were euthanized at a time when EBOV had already spread systemically. However, the segmental attenuation and loss of bronchiolar epithelium and the presence of Ebola virus antigen in some of the respiratory epithelial cells in the lungs of all macaques suggest that the airways were one of the routes involved in the acquisition of infection, consistent with previous reports910. Other routes of inoculation generally did not lead to lesions in the respiratory tract comparable to those observed in this study1213.

Under conditions of the current study, transmission of ZEBOV could have occurred either by inhalation (of aerosol or larger droplets), and/or droplet inoculation of eyes and mucosal surfaces and/or by fomites due to droplets generated during the cleaning of the room. Infection of all four macaques in an environment, preventing direct contact between the two species and between the macaques themselves, supports the concept of airborne transmission.

It is of interest, that the first macaques to become infected were housed in cages located directly within the main airflow to the air exhaust system. The experimental setting of the present study could not quantify the relative contribution of aerosol, small and large droplets in the air, and droplets landing inside the NHP cages (fomites) to EBOV transmission between pigs and macaques. These parameters will need to be investigated using an experimental approach specifically designed to address this question.

The present study provides evidence that infected pigs can efficiently transmit ZEBOV to NHPs in conditions resembling farm setting. Our findings support the hypothesis that airborne transmission may contribute to ZEBOV spread, specifically from pigs to primates, and may need to be considered in assessing transmission from animals to humans in general. The present experimental findings would explain REBOV seropositivity of pig farmers in Philippines23 that were not involved in slaughtering or had no known contact with contaminated pig tissues. The results of this study also raise a possibility that wild or domestic pigs may be a natural (non-reservoir) host for EBOV participating in the EBOV transmission to other species in sub-Saharan Africa.

Methods
Virus

ZEBOV strain Kikwit 95 was produced on VERO E6 cells in minimal essential medium (MEM) supplemented with 2% fetal bovine serum and antibiotics (Penicillin/Streptomycin). Virus titers were determined by standard TCID50 and/or immunoplaque assays on VERO E6 cells. Procedures for the production and propagation of ZEBOV and all subsequent experiments involving infectious materials were performed in the Containment Level (CL) 4 facilities of the Canadian Science Center for Human and Animal Health (CSCHAH).

Animal experiments

Four cynomolgus macaques were acclimatized in the BSL4 animal facility for two weeks, and housed in the same room for one week prior to the swine inoculation. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 15 cm in front of the cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 20cm above the ground, while top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP were sampled at 3 and 6 dpi (nasal, oral rectal swabs, blood) as per experimental schedule. Two macaques were euthanized for humane reasons at 8 days post exposure (dpe), and all animals were sampled at that time. Two remaining NHPs were in addition sampled at 11 dpe, and at13 dpe when they were euthanized. The animals were euthanized when typical clinical signs of Ebola infection became apparent, if possible prior to reaching the humane endpoint. Lung, lung associated lymph nodes, liver, spleen and intestine were collected at the necropsy.

Pigs (breed Landrace) were obtained from a high health status herd operated by a recognized commercial supplier in Manitoba, Canada. Three-week old piglets, designated as animal No. 1–6, were acclimatized for seven days prior to the inoculation in an animal cubicle already housing the non-human primates. The six piglets were inoculated oro-nasally with 2 ml of 106 TCID50 total per animal (0.5 ml per each nostril and 1 ml orally) in a room adjacent to the BSL4 animal cubicle and subsequently housed in proximity to cages with four non-human primates (NHP). Swine rectal temperatures were taken during the sampling performed under anesthesia on days 0, 1, 3, 5, 7, 12 and 14, when blood and rectal, oral and nasal swabs were collected. Three piglets were euthanized on day 12 post inoculation (no. 1M, 2M. 4F), and three on day 14 (3M, 5F, 6F), as per experimental schedule. Muscle, lung, liver, spleen, trachea, and submandibular, lung associated and mesenteric lymph nodes were collected at necropsy.

All animal manipulations were performed under CL4 conditions and followed Animal Use Document No. CSCHAH AUD# C-11-004 approved by the Animal Care Committee of the Canadian Science Centre for Human and Animal Health, according to and following the guidelines of the Canadian Council on Animal Care.

Virus isolation

Swabs collected into 1 ml of cMEM, blood, and tissues homogenized in MEM using a bead mill homogenizer according to the manufacturer's protocol (Tissue Lyser, Qiagen) were used for virus isolation and real time RT-PCR analysis. All NHP samples and swine rectal swabs were plated in 10-fold serial dilutions of supernatant on Vero E6 cells with six replicates per dilution. At 72–96 h post-infection the plates were scored for cytopathic effect (CPE) and TCID50 virus titers were calculated using the Reed and Muench method. Swine rectal swabs had to be however carried over onto replica plates for three passages prior to reading the CPE. Swine nasal and oral swabs, blood and tissues were first analyzed by real time RT-PCR targeting the ZEBOV L gene, followed by virus isolation on Vero E6 cells in P6 plates on selected samples.

Virus RNA detection

NHP samples: Total RNA was isolated from tissues preserved and homogenized in RNA later employing the RNeasy Mini Kit (QIAGEN). RNA from nasal washes and swabs was isolated using the QIAamp Viral RNA Mini Kit (QIAGEN, GmbH).

Swine samples: RNA was isolated using Tripure Reagent (Roche Applied Science) according to the manufacturer's recommendations from swabs, blood or 10% w/v tissue homogenates in cMEM. One-Step real-time RT-PCR was carried out using following primers and probe:

ZebovForward -CAGCCAGCAATTTCTTCCAT;

ZebovReverse- TTTCGGTTGCTGTTTCTGTG;

ZebovProbe FAM-ATCATTGGCGTACTGGAGGAGCAG-NFQ.

Armoured enterovirus RNA (Asuragen) was used as external extraction/reaction control. Quantitect Reverse Transcriptase Real-time PCR kit (Qiagen) was employed for the PCR reactions according to the manufacturer's specifications. Reaction conditions for the RT-PCR were as follows: 50°C for 30 minutes; 95°C for 15 minutes; 45 cycles of 95°C for 15 seconds followed by 60°C for 45 seconds. The samples were run on the Rotor-Gene 6000 (Qiagen) or on the the LightCycler 480 (Roche Applied Science). Copy numbers were determined based on the L-gene Ebola plasmid standard control curve. Cut off value for samples to be considered positive were 3 log10 copies/ml (Rotorgene) or 3.15 log10 copies/ml (LightCycler 480).

Air sampling

The air was sampled using BioCapture 650 Air Sampler (FLIR, Arlington, VA) on days 0, 3, 6, 8 and 11 post inoculation of the piglets. The air sampling started after husbandry, concurrent to NHP sampling, later in the morning before noon. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates. The collection took place over a span of about two hours in total (three 30 min collection times with changes of cartridges in between). The air sampler device collects particles by bubbling the air through a pre-loaded buffer (0.74% Tris/0.1 Tween 20) provided in a sealed cartridge by the manufacturer. This solution is not optimal for recovery of live enveloped viruses, and virus isolation attempts were unsuccessful. ZEBOV RNA was detected by real time RT-PCR targeting the L gene.

EBOV sequencing

Viral RNA previously extracted for real time PCR was sequenced by first generating cDNA with the use of Omniscript reverse transcriptase (Qiagen) and random hexamers along with specific EBOV primers followed by PCR with iProof high fidelity DNA polymerase (Bio-Rad) with specific primers (available upon request). DNA sequencing was carried out using the 3730xl DNA Analyzer (ABI).

Histology and immunohistochemistry

Tissues were fixed in 10% neutral phosphate buffered formalin, paraffin embedded using standard procedures, sectioned at 5 m, and stained with hematoxylin and eosin (HE) for histopathologic examination. Detection of viral antigen was performed using A 1:2000 dilution of rabbit polyclonal anti-ZEBOV VP40 antibody as described previously6. Identification of macrophages in the lungs was performed by immunostaining for the macrophage/monocyte marker L1 using Clone Mac387 (Dako, USA) primary antibodies. The tissue sections were quenched for 10 minutes in aqueous 3% hydrogen peroxide, prior to retrieval of epitopes using high pH AR10 (BioGenex, CA) in a BioCare Medical Decloaking Chamber. Antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes, and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. For the Mac387/Ebola double stain, antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using a multilink horseradish peroxidase labeled kit, Super Sensitive Link-Label IHC Detection System (BioGenex, CA), reacted with the chromogen diaminobenzidine (DAB). The sections were then incubated with a denaturing solution (1 part A, 3 parts B, BioCare Medical, CA) for 5 minutes, pretreated with proteinase K enzyme for 10 minutes, and rabit polyclonal anti-Ebola Zaire VP40 antibody was applied to the sections at a 1:2,000 dilution for one hour. The anti-EBOV antibody was visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. All sections are counterstained with Gill's hematoxylin.

References
  1. Leroy, E. M. et al. Fruit bats as reservoirs of Ebola virusNature 438, 575–576 (2005).
  2. Barette, R. W. et al. Discovery of swine as a host for the Reston ebolavirusScience 325, 204–206 (2009).
  3. WHO,. Ebola Reston in pigs. and humans,. Philippines. Weekly Epidemiological Record 7, 47–50 (2009).
  4. Marsh, G. A. et al. Ebola Reston virus infection in pigs: clinical significance and transmission potentialJ. Infect. Dis. 204 (Suppl.3), S804–S809 (2011).
  5. Jahrling, P. B. et al. Experimental infection of cynomolgus macaques with Ebola-Reston filoviruses from the 1989–1990 U.S. epizooticArch Virol Suppl 11, 115–134 (1996).
  6. Kobinger, G. P. et al. Replication, pathogenicity, shedding, and transmission of Zaire ebolavirus in pigsJ. Infect. Dis. 204, 200–208 (2011).
  7. Feldmann, H. & Geisbert, T. W. Ebola haemorrhagic feverThe Lancet 377, 849–862 (2011).
  8. Dalgard, D. W. et al. Combined simian hemorrhagic fever and Ebola virus infection in cynomolgus monkeysLab Anim. Sci. 42, 152–157 (1992).
  9. Jaax, N. et al. Transmission of Ebola virus (Zaire strain) to uninfected control monkeys in a biocontainment laboratoryThe Lancet 346, 1669–1671 (1995).
  10. Johnson, E.Jaax, N.White, J. & Jahrling, P. Lethal experimental infections of rhesus monkeys by aerosolized Ebola virusInt. J. Exp. Path. 76, 227–236 (1995).
  11. Roels, T. H. et al. Ebola hemorrhagic fever, Kikwit, Democratic Republic of the Congo (1995: Risk factors for patients without a reported exposureJ. Infect. Dis. 179 (Suppl.1), S92- S97 (1999).
  12. Baskerville, A.Bowen, E. T.Platt, G. S.McArdell, L. B. & Simpson, D. I. The pathology of experimental Ebola virus infection in monkeysJ. Pathol. 125, 131–138 (1978).
  13. Jaax, N. K. et al. Lethal experimental infection of rhesus monkeys with Ebola-Zaire (Mayinga) virus by the oral and conjunctival route of exposureArch. Pathol. Lab. Med. 120, 140–55 (1996).
  14. Larsen, T. et al. Pathologic findings associated with delayed death in nonhuman primates experimentally infected with Zaire Ebola virusJ. Infect. Dis. 196 Suppl 2, S323–S328 (2007).
  15. Geisbert, T. W. et al. Vesicular stomatitis virus-based vaccines protect nonhuman primates against aerosol challenge with Ebola and Marburg virusesVaccine 26, 6894–6900 (2008).
  16. Geisbert, T. W. et al. Postexposure protection of non-human primates against a lethal Ebola virus challenge with RNA interference: a proof-of-concept studyLancet 375, 1896-905 (2010).
  17. Donaldson, A. I. & Alexandersen S. Predicting the spread of foot and mouth disease by airborne virusRev Sci Tech OIE 21, 569–575 (2002).

Download references

Acknowledgements

We would like to thank Dr. Melanie van der Loop, Kevin Tierney, and Gary Wong for the assistance with animal care, to Peter Marszal, Jill Graham and Brad Collignon for the technical assistance, and to Dr. Soren Alexandersen for the critical review of the manuscript. The project was supported by CFIA and PHAC, with funding provided from the CRTI Cluster Activity fund CRTI-3780-2011-30va-17.

Author information
Affiliations
  1. National Centre for Foreign Animal Disease, Canadian Food Inspection Agency, 1015 Arlington St. Winnipeg, Manitoba, R3E 3M4, Canada
    • Hana M. Weingartl,
    •  
    • Carissa Embury-Hyatt,
    •  
    • Charles Nfon &
    •  
    • Greg Smith
  2. Department of Medical Microbiology, University of Manitoba, Winnipeg, Canada
    • Hana M. Weingartl &
    •  
    • Gary Kobinger
  3. National Microbiology Laboratory, Public Health Agency of Canada, 1015 Arlington St., Winnipeg, Manitoba, R3E 3R2, Canada
    • Anders Leung &
    •  
    • Gary Kobinger
Contributions

H.M.W. and G.K. conceived the study, design experiments, performed the animal experiments, analyzed and interpreted data, and wrote the manuscript. C.E-H. provided analysis of histopathology and data interpretation; A.L., G.S. and C.N. performed in vitro experiments and analyzed related data.

Competing financial interests

The authors declare no competing financial interests.

Corresponding authors

Correspondence to: 

Supplementary information
PDF files
  1. Supplementary Information (388K)

    Supplementary Information

     
 
 

Share this post


Link to post
Share on other sites

Thanks IbnSohan,

 

Things I found this morning:

 

Above at post #19, I cited the mosquitoe Aedes Agypti. This page and ones at "Health Desk" and all have been taken down. These pages came listed under mosquitoe transmission of ebola.

 

A 1995 study/report -WHO I think it was- cited collecting 34,000+samples and found nothing but one instance of Bunya. Another article citing negative results that I read before is still up.

 

However, if mosquitoes were not a problem -which doesn't explain why the WHO has declare a Global Health Emergency- there is the news article:

 

Nigerian Tribune, Friday, 08Aug14, "Latest on Ebola". At the end of the article, Governor R.Yero of Kaduna State says 69,000 impregnated mosquitoe nets have been brought into Kaduna, along with refrigeration and solar power.

 

A brief statement on Ebola is at:

"Are Insects Ebola's Natural Host/Resevoir?",  web.stanford.edu/group/virus/filo/insects.html

 

Bats as Ebola resevoirs is at:

"Infection Mechanism of Genus Ebolavirus" ,  microbewiki.Kenyon.edu

 

A Map of where these three species of fruit bats are can be found at:

"Geographic Distribution of Ebola Disease Outbreaks in Humans and Animals"  www.who.int/csr/disease/ebola/geographic-ebola.jpg

 

What I think is, Ebola is transmitted by mosquitoes, this is why WHO declared "global emergency", and gov'ts are not admitting this "to avoid panic" rather than get on with public awareness and prevention. Why else mosquitoe nets?

 

A couple of edu/gov articles say that the incubation period for Ebola is "2-21 days". Without closing off infected areas and interim quarantine before traveling to other countries or returning to the USA, then it appears plausible that a returnee from West Africa could be infected, get bitten by a mosquitoe in the US and start the spread here.

 

Info on airborne transmission is also mixed. But I have to ask the question: "If not, then why is Ebola ranked as a Category 1 bio-weapon?"

Share this post


Link to post
Share on other sites

Thanks IbnSohan,

 

Things I found this morning:

 

Above at post #19, I cited the mosquitoe Aedes Agypti. This page and ones at "Health Desk" and all have been taken down. These pages came listed under mosquitoe transmission of ebola.

 

A 1995 study/report -WHO I think it was- cited collecting 34,000+samples and found nothing but one instance of Bunya. Another article citing negative results that I read before is still up.

 

However, if mosquitoes were not a problem -which doesn't explain why the WHO has declare a Global Health Emergency- there is the news article:

 

Nigerian Tribune, Friday, 08Aug14, "Latest on Ebola". At the end of the article, Governor R.Yero of Kaduna State says 69,000 impregnated mosquitoe nets have been brought into Kaduna, along with refrigeration and solar power.

 

A brief statement on Ebola is at:

"Are Insects Ebola's Natural Host/Resevoir?",  web.stanford.edu/group/virus/filo/insects.html

 

Bats as Ebola resevoirs is at:

"Infection Mechanism of Genus Ebolavirus" ,  microbewiki.Kenyon.edu

 

A Map of where these three species of fruit bats are can be found at:

"Geographic Distribution of Ebola Disease Outbreaks in Humans and Animals"  www.who.int/csr/disease/ebola/geographic-ebola.jpg

 

What I think is, Ebola is transmitted by mosquitoes, this is why WHO declared "global emergency", and gov'ts are not admitting this "to avoid panic" rather than get on with public awareness and prevention. Why else mosquitoe nets?

 

A couple of edu/gov articles say that the incubation period for Ebola is "2-21 days". Without closing off infected areas and interim quarantine before traveling to other countries or returning to the USA, then it appears plausible that a returnee from West Africa could be infected, get bitten by a mosquitoe in the US and start the spread here.

 

Info on airborne transmission is also mixed. But I have to ask the question: "If not, then why is Ebola ranked as a Category 1 bio-weapon?"

You are welcome. You are correct, the airborne rout is not confirmed but highly suspected as outlined by the canadian public health site 

 

MODE OF TRANSMISSION: In an outbreak, it is hypothesized that the first patient becomes infected as a result of contact with an infected animal (15). Person-to-person transmission occurs via close personal contact with an infected individual or their body fluids during the late stages of infection or after death (121527). Nosocomial infections can occur through contact with infected body fluids due to the reuse of unsterilized syringes, needles, or other medical equipment contaminated with these fluids (12). Humans may be infected by handling sick or dead non-human primates and are also at risk when handling the bodies of deceased humans in preparation for funerals, suggesting possible transmission through aerosol droplets (2628). In the laboratory, infection through small-particle aerosols has been demonstrated in primates, and airborne spread among humans is strongly suspected, although it has not yet been conclusively demonstrated (1613). The importance of this route of transmission is not clear. Poor hygienic conditions can aid the spread of the virus (6).

http://www.phac-aspc.gc.ca/lab-bio/res/psds-ftss/ebola-eng.php

Share this post


Link to post
Share on other sites

In addition to your "mode" post, one article I read again today said touching the walls or the sides of tents transmit this disease.

 

So, unlike AIDS (time unknown) or Herpes (about 5 minutes), Ebola apparently remains virulent without a host for some unknown period of time.

 

 

 

Constructive criticism is always good, but I am starting to wonder if Deewan  and others are  ostriches.

 

(Rather than face fear, sticks its head in the sand.)

Edited by hasanhh

Share this post


Link to post
Share on other sites

blu115: I read that back in 1999. Good book. Remember how the Army tried to keep things secret during the Ebola Reston outbreak??

 

Yea, I thought it would lead to a major disaster, especially when one of the army col.'s there might have been infected when a monkey handler ran out and panicked. It piqued my interest that something big and bad would happen but nah.

Share this post


Link to post
Share on other sites

blu115:

 

I have been doing more online today. Nothing really new to what we have above.

 

One site mention birds as a possible carrier.

 

Another site was explaining that Ebola may not be able to "replicate" inside some mosquitoes, so those mosquitoes will not carry the disease like they do with  Family Flaviviridae.

 

Ebola and Marberg are Family Filovirdae.

 

So maybe there is some good news. Ticks, though, were listed as a probable carrier.

 

 

One of the things I remember about "Hot Zone" is their going down to the stores to by chlorine to disinfect the place in Reston. Until reading this week, I didn't know Ebola-Reston was traced back to the pigs in the Phillippines, and the pig farmers have anti-bodies for this.


Forgot:

 

If you want a compendium of sources, go to Filovir.com

Edited by hasanhh

Share this post


Link to post
Share on other sites

Sun1OAug14:

 

BBCNews, 0729hrs EDT

 

"Ebola Virus: Liberia health system 'falling apart' "

 

quoting Medicine Sand Frontiers

 

-5 hospitals in Monrovia have closed

 

-in some countries, hospitals are being abandoned by their staffs.

 

 

In another report, "patient zero" from where the current outbreak started is from a 2 year-old boy, Dec2013, in a village in the tri-country area of Liberia, Guinea and Sierra Leone.

Share this post


Link to post
Share on other sites

Sun10Aug14:

 

NBCNews: 1830 hrs:  In Liberia, riot police are confronting people angry over bodies not being buried. Nigeria is now starting airport monitoring.

 

Washington Post, 09Aug14: "Four new cases in Nigeria..."

 

--For Aug 5th and 6th, the WHO reports 29 more deaths (3 more in Nigeria).

 

--The Chart at WashPo is dated 04Aug14.

 

What I find "eerie" is that national broadcast news this week --including today, Sunday the 10th-- is still reporting the 932/931 number of Monday the 4th. New deaths and cases are not being reported --the 29 deaths I copied from WashPo article.

 

 

Edited by hasanhh

Share this post


Link to post
Share on other sites

Christians throughout history have believed that the rise of deadly diseases is a sign of the end-times. The Book of Revelation gives us a good guideline on what will happen in the future just prior to the second coming of Christ. I don't know what Muslims believe about end-times history but many people - not only pagans but many Jews, Muslims, and Christians - will be fooled into worshiping the Antichrist. There will be no worldwide Muslim takeover of the world because the Antichrist will beat every other religion on this matter. 

Share this post


Link to post
Share on other sites

The "book of Revelation"/Apocalypse was written by the Bishop of Alexandria in 195CC based on the popular religious literature (like Ben Hur , The Robe and others) "Book of Daniel" --which is seriously historically challenged.

Share this post


Link to post
Share on other sites

www.who.int/mediacenter/

 

There is a fact sheet on Ebola.

 

What is "new" is that "forest antelope" and porcupines found sick or dead are now documented as sources of transmission.

 

Three species of fruit bats are considered the "hosts" for Ebola (like rabies since bats are immune to it -ed.) ...

 

The map of these 3 species of bats are considered the primary risk area...and

 

As fruit bats are around pig farms --pigs being a host and a source of transmission to Man as documented in Africa and in the Phillippines (for Ebola-reston --ed.) this is another hazard.

 

That's from the WHO fact-sheet. It's a good summary read for today's date, although it excludes deaths.

 

Also, Nigeria is reporting another nurse's death today, Monday the 11th.

Share this post


Link to post
Share on other sites

(salam)

 

1345hrs, 11Aug14:

 

In the last hour or two:

 

Nigerian Bulletin: "Senegal, Rwanda Report First Suspected Ebola Case":

--a student from Germany traveled from Liberia to Rwanda, is in King Faisal Hospital

--Senegal said suspected case is a 27 year-old Malian

--Liberia: 2 more health care workers died today, one from the Congo

 

--but, in Geneva, "ethicists" are talking/debating the use of experimental treatment (from the US and developed from post-9-11 bio-warfare funding --ed.) while, according to the Brampton Guardian, Spain has imported this treatment for the infected priest in Madrid.

 

In other news items, two Catholic Archbishops in Nigeria, have banned physical contact during Mass as a disease prevention measure -this according to the Catholic News Network.

Share this post


Link to post
Share on other sites

(salam)

 

12Aug14:

 

Update: "ethicists" mentioned above have "approved' using the experimental treatment.

Cite: "WHO Panel says unproven drugs are ethical as Ebola deaths top 1000", CNN 12Aug14 1747GMT

 

The husband of the woman Ebola patient and another aid worker returned to the US and will be quarantined for 3 weeks. The conditions of their travels was not described. Hopefully they were in suits and 'isolated'.

 

An article in Forbes is discussing measures in case of an outbreak in the US.

 

"Ebola Death Toll in West Africa passes 1,000", AP, 11Aug14 2057EDT

--over the period Aug 7-9 there were 52 more confirmed deaths and 69 infections.

--toll at 1,013 deaths

 

Public Health Agency of Canada, Pathogen Safety Data Sheet-infectious substances

--para. 3: Ebola targets "...blood coagulatives and immune defence systems..."

--para. 4: variations in Ebola strains "...lies in the genome, which can vary by 30-40% from each other."

--Section: "Host Range" --Ebola was found in two rodent species and one species of shrew

--Section "Mode of Transmission": adds "...and airborne spread among humans is strongly suspected..."

--Section "Survival Outside of Host:: "The virus can survive in liquid or dried material for a number of days.23

-------note .23 cites: Leroy, et alia, "Multiple Ebola Virus Transmission events and rapid decline of Central Africa Wildlife", Science, 303(5656), 387-390

 

A good map of the outbreak up to 04Aug14 is at:  "Special Ebola Virus Issue" 16Aug14. epimonitor.net/.../Aug-2014

 

A good read:

www.ufrgs.br/.../pathoviruses-fi... 

title: Filoviridae

--Section: Transmission:   In the Gabon-Republic of Congo hundreds of carcasses were found and examined, mostly gorillas and chimps had Ebola but other animals did too.

--Section Ebola, subsection Transmission: discovered Ebola transmitters leaf hopper insects, in feces, and Ebola is evolving

 

Other research by me and comment:

 

As in above posts, the herbivores porcupine and forest antelope are listed. Antelopes are grazers so they can be acquiring Ebola from fecal matter on grass or being bitten by sick animals(rodents, etc). Porcupines eat grass and tree bark but also have been observed dragging carcasses to their dens and eating them (South African Porcupine --South meaning sub-sahara savanna to the Cape --ed)

 

Since it is not (publically) conclusive about mosquitoes, tse-tse or Aedes Aegypti, I looked for an obvious insect: Flies

So what I found is:  ento.psu.edu (Penn State) on House Flies, which carry 65 diseases -polio, yellow fever, etc- but I'll add what we were taught, rabies (which is why we were told to burn a known or suspected carcass in situ because flies carried it)

 

I also looked up Horse Flies, which cut into hides (thick skin) with "scissors" for mouths.

 

What both have in common are hairy legs, blood sucking, regurgitation. So any flies landing, walking, sucking/laying eggs on an Ebola infected mammal with transmit this disease even into a cut, scratch/scab, open wound and may deposit active viral onto food.

:sick:

 

Flies maybe the biggest threat.

 

Also:


Mapp Biopharmacuetical has run-out of the serum they were producing; a bio-pharma in Kentucky is ramping up on a similar serum; Glaxo-Smith-Kline is starting a "vaccine" trial.

 

For something like "creepy science fiction" but real,

TIME, "Fear and Rumors Fueling the Spread of Ebola", by Mirren Gidda, 0733 hours EDT, 12Aug14

I can't think of a vocabulary word to describe this.

Edited by hasanhh

Share this post


Link to post
Share on other sites

(salam)

 

This speaks for itself.

 

"Nigerian nurse skips Ebola quarantine in Enugu", The Daily Star (Lebanon), 13Aug14

 

Some info: the article says there are 20 in quarantine and 189 "watched".

 

Doing some Wiki reading I found the following on Enugu, Nigeria:

--pop. 722+K

--also known as "Coal City"

--and also this area is known as "Nollywood" for the film industry's preferences

--the economy is "open markets" and child street hawkers (the age group least likely to exercise judgment and caution)

--located in a region that produces one-half of the World's palm (oil) kernels.

--has a railroad to Port Harcourt

 

Speculating as to why this nurse would "skip" quarantine after coming from Liberia after apparently attending Ebola victims? (also see post 32 above)

Though the time varies from village to village after the rainy season, this part of the areas/countries that celebrate Iwa ji Festival -a harvest festival for the yams --which occur in the August to October time frame and has some date setting by the Moon.

Trying to find the date of Enugu's Iwa ji, the only thing found was a reference (in a foreign country) saying it starts August 16th.

 

Yarrabi...

Share this post


Link to post
Share on other sites

(salam)

 

A follow-up article on this criminally irresponsible nurse:

 

allAfrica.com, from "Daily Trust", "Nigeria: Breaking --Ebola Spreads Further as 21 Quarantined in Enugu -FG", by Isiaka Wakili, 13Aug14

--21 in Enugu State

--Nigerian gov't has "... traced 198 persons that had primary and secondary contacts with (Liberian-American diplomat --ed.) Patrick Sawyer who brought the virus to Nigeria from Liberia".

--177 are in Lagos, 21 in Enugu who all had contacts with the nurse "that had primary contact with Sawyer in Lagos"

--"The minister explained that the nurse disobeyed medical instructions and traveled to Enugu."

 

Another article said that 5 Indian doctors want to leave Nigeria. -FirstPost(India), 14Aug14

 

"More than one million people affected by Ebola outbreak -WHO", Times of India, 14Aug14

--128 new cases

--56 reported deaths for Aug 10-11

--1975 cases

--deaths 1,069

--"...170 health care workers have been infected, more than 80 have died."

--Damage to the Economies: airlines cancelling flights; companies moving staff out of (affected) regions

 

A description of the pathetic health systems, see:

"Your View: Stopping Ebola's spread needs action", by Gary F. Souza, South Coast Today, 14Aug14

Edited by hasanhh

Share this post


Link to post
Share on other sites

(salam)

14Aug14:

 

Canada Free Press, "The Story of Ebola in Reston, Virginia", by Dr. l J Paugh, 05Aug14

 

She recounts the story written in The Hot Zone by Richard Preston

 

A good quick read on REBOV   -RestonEBOlaVirus-  ; some excerps:

 

----"...Ebola(Reston-ed.) apparently drifted through the building's air handling ducts. (pp.251-252)"" (She is quoting the book)

---From examining the "...lungs, everyone at USAMRIID concluded Ebola(Reston-ed.) can spread through the air. (p.254)"

----"You can see the Ebola(Reston-ed.) particle clearly in the air spaces of the lung", said LTC Nancy Jaax, Chief of Pathology at USAMRIID in 1989, a participant in the Reston biohazard operation. (p.260)"

 

Another map:

BBCNews, 14Aug14, "Ebola: Mapping the Outbreak"

 

--has a couple of charts, too.

Share this post


Link to post
Share on other sites

(salam)

blu115:  Thanks.  As I noted in post 40, 80+ health workers are dead from Ebola. Unless there is a serious deficiency in their equipment, I do not know what is killing so many. Loss of protocol from heat stress I do not think would kill so many. In mlty service, we had these MOPP 4 suits which are charcoal lined and very hot. I do not remember any loss of performance from heat stress. Therefore, I think there is another conduit to the disease, something being contaminated well away from their barrier-nursing sites.

I figure it is flies.

 

Did you read the Time or "your view" articles above.? They describe sick situations.

 

 

In school, we had this numbers game: If I give you a penny today, give you 2 cents tomorrow, and keep doubling the amount I give you each day...how many days will it be before I give you a million dollars?

Similarly, as a spread of disease, 2 exp 33 (233)  is about 8.5 billion. Planetary population is 9+ billion.

Share this post


Link to post
Share on other sites

(salam)

 

Several news media are carrying this from Reuters, 14Aug14, "Ebola Outbreak Vastly Underestimated: WHO"

 

--nothing factual in the article, but implies more than unreported cases from remote areas.

--WHO issued an alert for Kenya, this I read at VoA News.

 

Above, I mention 233, well now think 319 ---> 9.1 Billion

Share this post


Link to post
Share on other sites

(salam)

15/16Aug14

 

"UN to feed 1m people hit by Ebola", AFP, @ Dawn.com

-----"The WFP is alreadt feeding several thousand in the worst affected areas,..."

 

"TRF -WFP sacks up food deliveries overland to Ebola Region" Reuters, 15Aug, 1417 EDT by Stella Dawson

-----1145 confirmed Ebola deaths

-----PBS News added there are 2100+ confirmed Ebola cases

 

"Hospitals in the US Get Ready for Ebola", NYT, by Catherine Saint Louis, 15Aug14

-----new CDC "advice" says no "head-to-toe moon suits" ; "only gloves, fluid resistant gown, eye protection and face mask..."

----- However,  a doctor from Massachusetts General Hospital who tackled Ebola in Zaire says that was what the nurses there wore and they all got Ebola

 

Nigerian Tribune, 16Aug14 "Ebola Scare in Ibadab, Ekit as UCH orders screening of patients"

-----University College Hospital, Ibaden, Oyo State

-----a potential Ebola patient with blisters was allegedly turned away. The hospital officials deny this.

-----Hospital policy is that everyone is screened first to control access to areas of the hospital

----- the "doctors are on strike"

----- This Article has a summary of the current status of vaccines, experiments and testing

 

Nigerian Tribune, "Nigerian doctor recovers from Ebola", 17Aug14

-----a Nigerian doctor that treated Finance attaché Patrick Sawyer: she has recovered

-----a bush-meat hunters new group, a "legal practitioner", are proclaiming a "Western Plot" over Ebola

-----also complaints abut interfering with local medical practices --like bat soup cures

 

Other Info:

 

Fly Management Handbook, www.ct.gov/...

"[Most? -ed.] (p)athogens do not survive the change from a larva [maggot] to adult fly"

wasps make parasitic attacks on flies

 

Wikipedia, Muscina

"Most of the bacteria and viruses are not introduced from the fecal material to the fly when it is in the egg or larva form, rather the transfer occurs in the transition of a young fly to adulthood"

--the pathogens are attached to the outer body;

--later, it is in the saliva and feces of flies from the feeding source

 

Neotropical Ceratopogonidae, by Art Borkent, 2007

---midges (small flies) also carry diseases (likewise-ed.)

 

Above, post 19,  I mentioned remembering a mosquitoe being blown into Indiana from a hurricane. By accident and maybe the same thing I found: Aedes albopictus also known as the Asian Tiger Mosquitoe; Hawley,WA, J. Med. Entomol 26:122-129

Edited by hasanhh

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now


×