HassanShia

Evolution And Islam?

Rate this topic

214 posts in this topic

(bismillah)

(salam)

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

Arguments and evidence do.

It makes the person more reliable, because an expert in a field has spent golden time in lecture and seminars, learned the concepts, written theses, drooled over the fossils, made a living thinking about them and is therefore more reliable and thorough a person to draw conclusions from the evidence than anyone else.

You'd expect claims of proving the Riemann Hypothesis would be evaluated by expert and reputable mathematicians; quantum theories by theoretical physicists; law by judges; history by historians who have spent years swimming in their material; Arabic by experts in Arabic language and grammar; the same applies to biology.

If you are an expert yourself, please come forward and give your opinion and the rationale behind it. If you are not, then if you're going to take a scientific stance (which you don't need to), have more respect for the scientific ultramajority, because theirs is a theory which has convinced the majority of the experts in that field.

(wasalam)

Share this post


Link to post
Share on other sites

These are direct examples of evolution that we have seen with our own eyes. So how might you explain those? Its not just adaptation because there are genetic changes, there is genetic evolution of populations. So what say you about this simple concept?

Red hair is an example of genetic mutation (and recessive), what's your point?

You saw "the fossil record," so now that's fact which we've seem with our own eyes?

From the same esteemed experts who brought us such conclusive evidence such as' piltdown man?'

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

It makes the person more reliable, because an expert in a field has spent golden time in lecture and seminars, learned the concepts, written theses, drooled over the fossils, made a living thinking about them and is therefore more reliable and thorough a person to draw conclusions from the evidence than anyone else.

Ah thanks buddy :}, next time we get in a philosophical dispute ill take the benefit of the doubt and give you credence. Which I kind of already try to do anyway (even if i dont admit to it) lol.

Red hair is an example of genetic mutation (and recessive), what's your point?

You saw "the fossil record," so now that's fact which we've seem with our own eyes?

From the same esteemed experts who brought us such conclusive evidence such as' piltdown man?'

I was thinking more along the lines of the examples i gave in the topic i made (CCR5, LDL receptor protein mutation). But anyway, the point is, beings, humans included, are mutating. Our DNA is transforming within us, and we are spreading those transformed genes onto our offspring. This is evolution, this is how it works. Physically we are changing ever so slowly over time. And dont try to say "oh its just micro evolution or its just adaptation" because obviously its not adaptation if our dna is ever mutating, and dna changing is dna changing...morphological features changing are morphological features changing. Thats all there is to it, either it is occuring or its not. Im saying it is, and thankfully we can see that it is, therefore we can see that evolution occurs.

And before we move onto the fossil record i want to dig down into this one.

Share this post


Link to post
Share on other sites

And before we move onto the fossil record i want to dig down into this one.

Okay, we are in agreement that our DNA is changing/ mutating etc.

I don't quite see how that translates to being "not adaptation if our dna is ever mutating."

But please continue.

Share this post


Link to post
Share on other sites

Adaptation YES

Evolution NO

You have chanted this mantra in other threads and each of these times i have consistently told you, if you have adaption, you have evolution. Things evolve by a process of adaption, its an automatic correlation. If things adapt then they evolve. There is no two ways about it. If you don't understand this then you don't really understand the basics of evolution, at all.

In which case i would suggest my book or maybe the link in iDevonian's signature.

Evolution lacks sufficient evidence to remain conclusive.

Comparing animals with human beings is also stupid. We're far too sophisticated and our self-awareness is what sets us apart.

There is avalanches of evidence. Why do you think its accepted by pretty much every biologist out there? These certainly aren't stupid people. If there was such a lack of evidence as you describe no serious scientist would believe it, it would be a fringe theory. However, there is an abundance upon an abundance of evidence. Unless you think its some kind of conspiracy... but otherwise, these are smart people and they have good reason to believe what they do.

Comparing animals with human beings? We are animals though. We're in kingdom Animalia, we are animals. This is incontrovertible.

Everyone keeps asking for evidence but no one wants to see it, its such an absurd situation. Just look at some of the evidence that iDevonian has shown you all.

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

I honestly believe it does. I think a lot of people have a *fundamental* misunderstanding theory of evolution. It's not just one single, isolated simple idea. Darwin didn't even know how changes were passed on for example, it was only when gregor mendel ( a catholic monk who bred pea plants ) discovered genes and this is how change is passed on. So, there are already two things you need to understand. You need to understand genetics (not just at a bare bones level either) to understand evolution. Genetics is about how the DNA simply is though but to understand what the DNA is made of, how the information is stored, processed, copied ect you need biochemistry. I say "biochemistry" or "genetics" like they are small, single focus disciplines, they aren't. I think its often underestimated just how much "stuff" falls under these two headings of areas, theres a huge amount of different things contained within them.

You need knowledge of all these things and more to understand evolution. It simply just doesn't pop out of the sky and into your head. I totally accept you are able to learn without a degree, of course i do. It's a lot harder though and can be muddled up, nonwithstanding the kind of dedication such a thing would require. A degree proves that you've been able and have learned these things though.

Practical experience in a lab greatly helps as well. Reading books is great but it can only get you so far. I've spent Friday afternoons in the lab mashing flies to extract their DNA to separate it out using electricity ( https://en.wikipedia.org/wiki/Gel_electrophoresis ). Obviously, not my idea way to spend my friday afternoons but these kind of sacrifices come along with the process of being educated.These kind of things naturally come along with a degree, time spent learning something. It's also what gives a degree market value, its why university educated people tend to make more, because they have skills and knowledge a lot of other people don't have, the supply is low. Compared to being able to work at your local grocery, which almost everyone can accomplish, you're replaceable and have a huge supply of excess labor.

I think this "piece of paper" does make your view stronger, you wouldn't argue a doctors view is worth less than the average man on the street would you, just based on his piece of paper. I'd quiet like a man with that piece of paper treating me if i ever fall seriously ill. Thats what university is all about, higher learning, learning at a higher, more specialized level.

No one here ever seems to question pretty much any other profession based on a piece of paper except when they have some beef with that profession. Accountants, psychologists, journalists, historians, managers, engineers, town planners, ect. I don't often see people question their qualifications, so its not a problem with an actual degree. It's just that you don't like the views of the professions that happen to be degree educated, in this case biologists. So, i think this criticism is kind of empty unless you're prepared to accept it for all the above people as well.

--------------------------------

--------------------------------

--------------------------------

As in regards to Jebreil, you seem to be very reasonable and respectful in these forums but i do not at all understand your challenge otherwise i would be more than happy to oblige it to you. Could you please clarify?

Are you trying to find a biologist that thinks the theory of evolution is false? They're very few and far between, especially biologists that work on larger things as opposed to people like biochemists. I don't think you'll have much luck finding a person like this, let alone here where people with biological qualifications at all are even more few and far between.

I wouldn't go as far as to say they don't exist but i've read surveys about this on wikipedia, the number is something ridiculously high like 99% of biologists accept the theory of evolution (https://en.wikipedia.org/w/index.php?title=Level_of_support_for_evolution&oldid=470082824 ).

I think just by the nature of the idea, you'd find very few scientists who have went through all that education and dedicated their lives to studying a theory that they don't believe in. I'm sure they think they have better ways to spend their lives. Same with my philosophy of religion professor, apparently athiests are a minority in philosophy of religion, at least in this country because if you don't believe in a God, you're not going to care much either way really (well for most anyway). Same kind of deal.

--------------------------------------

--------------------------------------

--------------------------------------

iDevonian is a geologist so i'll leave the fossil record to him, i could cover it but i think its better i handball it to him.

Like I've said previously, if people actually genuinely don't want to learn or listen and have already hardened their minds prior to seeing and understanding all the evidence, i am not going to throw away my time.

Here is a good place to start - https://en.wikipedia.org/w/index.php?title=Introduction_to_evolution&oldid=472297480 / http://evolution.berkeley.edu/ (evolution 101).

However, the book i mentioned earlier in the thread is a very very good place to start. It shouldn't be too hard to find.

Just for the benefit of those who actually want to learn and the many anonymous people who are bound to come across this by using google (half the reason i ever write stuff here), i'll very very briefly present a couple pieces of evidence. As i said, ill leave the fossils to iDevonian but i'll tackle some of the more...squishy..things.

Still, i absolutely recommend you read those two links above, like i said, evolution isn't an isolated thing, you need to understand many other things to fully grasp evolution, so that kind of knowledge is definitely necessary.

I also realise, without giving everyone a comprehensive background education things might be a bit hard to understand or might not seem like its that important but to cover all those things would take a great deal of time. If theres anything that genuinely needs clarification i'd be happy to oblige. Once again, i recommend those links and very much more so, that book. It's probably the 2nd book i ever used seriously. It's a general biology book, so its not too hard to understand but its written for a college level. Certain knowledge is already assumed from the other chapters, so someone reading those chapters in isolation probably won't understand everything but the good thing about it being a general biology book is that you can go back and read the little bits of the biochemistry or genetics section you need to know. I think i also mentioned a much more simpler (but slightly less comprehensive) high-school level biology book. These are books I've both personally used and i can vouch for them. I don't really think its a wise idea to start recommending books soley on evolutionary biology because of the various things i've mentioned above.

Again, i'll have to considerably simplify things to reach as wide of an audience as i would like to. It might seem at certain points i'm just taking things as a given or that there doesn't seem to be all that much behind a certain idea but i assure you, behind all the things i present, there is. If you would like to know this and if it won't take a hugely extensive explanation, i'll try get to it.

A few very brief points of evidence for evolution occurring

Genetic Sequences

Before i start, as i mentioned above, this is one of the more difficult areas without sufficient background knowledge. Probably one of the most difficult actually.

So, i'm sure we all know we have DNA. You've seen pictures of it, you often hear it mentioned but not many actually know what precisely it is.

It's made up of a couple different parts, most i wont mention here. It has a backbone of sugar-phosphate, which is more or less what it sounds like. Out of this backbone stands the "nucleotides" or "bases". These are basically how information is stored in DNA.

Now DNA is a universal genetic code, this means on a very basic level that it works the same for all forms of life that exist on earth. From the simplest single cell organism right up to things like dinosaurs. It's all fundamentally constructed in the same way.

These bases i mentioned are 4 different chemicals, we represent them as A T G and C. These are the first letters of the chemical they are made of, so A for example is Adenine.

The unique thing here is that A always sticks to T and G always bonds to C. Why they always do this is way beyond the level needed here but you could just think of them being very attractive to each other.

dnabasepairs.jpg

This is what i was talking about earlier. You really need to understand what a "sugar" is and what a phosphate is. What hydrogen bonds are, why two bases are purines and two bases are chemicals called pyrimidines. You need to understand where the nitrogen is in that diagram and how they attatch. There are so many things that are really needed. This is why it isn't exactly an isolated subject.

Again, i'd just like to reiterate why DNA is important. Things obviously change and adapt in evolution but how is that passed onto your children? Your DNA. This is why DNA is of fundamental importance to evolution.

Why is DNA important itself though? You can think of it as a recipe book. Every piece of DNA in your body (simplification) is exactly the same. The DNA in your eyeball has the "recipe" to make a tooth. The DNA in your skin has the recipe to make cardiac proteins in your heart. Why doesn't the "chef" cook all these things for all the cells in your body? Why don't you end up with teeth in your eyes? This is a very important area in genetics and medicine. Often when things are turned off or on when they shouldn't be it causes very serious problems a lot of the time.

DNA is kind of the recipe book to make things called amino acids, string together enough amino acids and you have a protein. This process is called "Translation". You can kind of think of it as a chef "Translating" the words in the recipe book into actual useful food you and i can eat. There are tables out there that you can look up for example (https://en.wikipedia.org/wiki/DNA_codon_table).

See that table, see what is familiar? The A's and the T's and the G's and the C's are in there, these are the things i was previously talking about before.

I can't really explain why in such a short amount of time but when translation occurs, only a single strand of DNA is looked at. Your DNA is split into two strands. Think about why this can work?

Figured it out? Even if we only have one strand of DNA, not stuck to its partner, we can still figure out exactly what its partner would be. If we have a single strand (dna is usually double stranded, hence how it winds around itself) with AATTGCA, we can figure out that the other strand would have TTAACGT because of the rule i mentioned before, how those bases always partner up. This is why if you get a sample of DNA and find out it has 33% of the chemical A, then it must be composed of 33% of the chemical T. Then following that idea out, we must have equal amounts of G and C. Since we are left with 33%, we have 16.5% G and of course, 16.5% C present. I hope this is at least semi-clear to everyone, i know its a lot to take in and often you learn a lot more before you get here.

translationdna.gif

Back to the above linked table. DNA is "read" by the "chef" 3 bases at a time. So the chef looks not at A but at AGC or TTA. This arrangement of 3 bases together is called a "Codon". If you look in the picture, you'll see the "white thing" is attatching to 3 of the "yellow things" at a time. This gives the directions to produce one amino acid. How do we know which amino acid to make? It depends on the sequence, so if we once again refer to the table (https://en.wikipedia.org/wiki/DNA_codon_table), we will find that "TCT" makes an amino acid called Serine. CAA makes an amino acid called Glutamine. We string these amino acids together in a chain to make a protein. A protein is composed of many amino acids linked together.

Heres the key, the genetic material in ALL LIFE (ex very special viruses like HIV but most dont consider viruses to be alive, even in these cases they still indirectly use DNA) is made up of these four bases. We use GTCA. A cheetah uses GTCA and a bacteria uses GTCA. They also make the same proteins. So, "TCT" would make Serine in a human and "TCT" would also make Serine in a pig. This is why it is called a universal genetic code.

This is why genetic engineering works. We use to have to harvest insulin from pigs. It wasn't always the purest or easiest to work with and some people had objections to obtaining it from pigs, rightly so i think. However, we progressed to a point where we could use genetic engineering. We found the particualar gene or "recipe" to make insulin in the pigs DNA. We took it out of the pig and spliced it into the DNA of a bacteria. Guess what, that bacteria started producing an exact replica of porcine (pig) insulin. Without the additional hassle of all the things involved with pigs and we were able to grow bacteria on a much easier and larger scale. Thats the kind of unversality i am talking about. Thats why we're able to put fire fly genes which cause the fly to glow, into plants (totally different kingdom, animal DNA into a plant) and guess what, those plants glow!.

Glowing_tobacco_plant.jpg

This is a tabbaco plant that didn't previously glow. As far as im aware, they spliced in the gene from a firefly and it did exactly the same thing in the tabacco plant, because the genetic code IS universial.

Just very briefly why proteins are important. Think about it, they make up your heart muscle and indeed all your muscles. Your hair, your skin, proteins hold pretty much everything together. They drive most of the chemical reactions in your body, in the form of enzymes. Enzymes are proteins that speed up reactions above their normal rate. Your cells are constantly producing toxins, one is hydrogen perioxide. H2O2. If you left a container of H2O2 on a bench, it would eventually break down to forum H2O (water) and O2 (oxygen). However, this would occur at way too much of a slow rate, it would just keep building up and building up since our cells constantly make it. You would die fairly quickly.

We have a an enzyme (enzymes are made of proteins) called catalase. It kind of actively rips apart the H2O2 into oxygen and water at a much much faster rate. Instead of the slow rate, it rips millions of molecules apart *per second*. One singular, lonely catalase molecule can do several million in one second. This is only one molecule. It would be the equivalent of me gluing together several million blue and red basketballs, throwing them at you and you pulling them apart. How many do you think you, as a single person, could pull apart in one second? Maybe not even one set. This single molecule does millions in a *second*. This is another reason why proteins are important.

So, we've established the genetic code is universal and why proteins matter.

You'll say that this doesn't prove anything! I'm about to get to that.

In his series on the BBC about darwin, richard dawkins (not a great philosopher and i dont really like his attacks on religion but he is a very good biologist) remarked that even if we had no other evidence available to us, comparing the DNA sequences between species would still be overwhelming proof.

We can "sequence" DNA. We can figure out the entire sequence of bases in an organism ATTTAGCAATGCAATGACAAAATAGCA ect ect. Not all of your DNA produces proteins, a lot of it is "junk dna" (not really considered junk anymore but for our purposes it is) and it doesn't produce anything. It's sort of like a recipe book written in a language you cant understand or full of food you hate. Its useless. If we match up our DNA against that of one our closest relatives, the bonobo, we find there is only about a 2% difference when we compare the parts that produce proteins which makes us what we are. So, we share many and many of our genes with them.

To understand why this is important you really need to understand what a species is and how speciation occurs. This is why darwins book was titled the origin of spcies. Understanding the process and ideas of speciation is of fundamental importance.

Say i have a particular population of crabs, these crabs are all the same. Lets say they graze on a certain beach in the carribean. They intermingle and breed which each other just fine. Pretend an earthquake opens up or a volcano errupts and divides this population in two halves, seperated by a rift or mountain of rock. I could errect a fence. The object seperating them doesnt matter all that much. Lets say they feed over a quiet large area but on one side of the fence, there is a species of soft shelled sea snails but these are quiet fast snails. On the right, we have hard shelled snails but they are quiet slow. Within days and months the crabs on both sides are the same. However, on the left, crabs who are faster and perhaps have smaller bodies and claws, would do a better job at catching these fast snails than crabs of normal speed. They'll get more food than the other less fit (in a biology sense, meaning most well adapted for a situation) crabs, they'll have less chance of starving, they'll develop more shiney attractive bodies, they'll be healthier ect.

This is where natural selection comes into play. Variation already must exist in a population to be selected for. Some of us are short, some are tall, we vary. Same with out crabs. Some are very large and slow, some are small but fast. Over time, the smaller faster crabs will be able to get more food, hence be healthier and have less chance of dying, be more sexually attractive and they would reproduce more than the less fit crabs. In the next generation, you'll find you have slightly more smallers, faster crabs than the previous generation. In the next generation, even more slightly smaller crabs than the 1st generation. I hope everyone can understand why this would occur.

Same with the crabs on the right of the fence. They don't need speed. Small and weak clawed crabs (but fast) wouldn't be selected for. In this case, we have very slow but very hard shelled snails. In this area, crabs with huge but powerful claws will get more food, be healther, be less prone to disease, ect than regular crabs. More of these well adapted crabs will survive and reproduce than the less well adapted crabs. Since you get your genes from your parents, their offspring might prosess this trait as well. Since more of our "supercrabs" had more of a chance to breed, more of the next generation would be "supercrabs"/

This is one kind of speciation called allopatric speciation. Literally, "other land" speciation. It occurs when populations seperate ( https://en.wikipedia.org/wiki/Allopatric_speciation ).

What defines a spcies, how do we know if things are the same species? If two animals are able to successfully interbreed and produce fertile offspring, they are the same species. Its why crabs can mate with crabs but not with goldfish. Their number of chromsomes if different, they're physically different, they reproduce differently, they dont recognise each others mating calls ect.

Eventually over time, the crabs on the left and the crabs on the right will become so different they can't interbreed. Neither sides are the same as the original crabs prefence/erruption, these crabs were the ancestors but they no longer exist. We now have two species which have descended from those crabs.

Various reasons why they might not be able to interbreed. Their DNA and number of chromosomes could change so much that it simply wouldn't match up. Afterall, selecting for all these variations and changes results in a change in DNA. Natural mutations and sexual recombination occur over time but would take different paths in these two seperate crab populations. They might not be able to interbreed.

Another reason might be time. The crabs on the left might become noctural and the crabs on the right might not be. They might never get a chance to meet.

Their mating calls could become different because they are seperated (much in the way that you speak arabic only and i speak english only for example) that they might not recognise each other as potential partners and go on to mate.

They could become so physically different mating isn't possible.

One of many reasons.

So, we have two distinct species. They're obviously still crabs but they're different kinds of crabs now. You can tell just by looking that they're more or less the same. They only split off recently, they haven't had much time to change. If you compared their DNA and their proteins many thing would still remain the same because they split off from the same ancestor only recently.

Lets pretend our "superman" crabs on the right again become seperated. We take one and put it on a beach where the snails sting and we leave the others where they are. The crabs on the beach with the stinging snails will once again change, overtime youll see crabs that are more resistant to the stinging (Chilli doesnt at all feel hot to birds for example and yet to us it does). These "Pain-Master" species of crabs that can reduce pain from stinging are more distantly related to the ancestor crabs now. I'm sure we can all see why this is. Even more time has passed, even more changes have taken place. We can compare their DNA and features and see that our "Pain-Master" crabs have less in common with the ancestoral crabs than do our very fast but weak crabs on the left.

So, we can compare the genetic sequence and using this we can infer how recently we split off. This is why the difference between our DNA and bonobos is so small, because we split off so recently (n a biological sense). A human and a mouse? Sure, mouses are still mammals, we have many similarities. We share less in common but we still share a huge amount of DNA. This is why we can use mouse models to test drugs and experiment on. A human and a chicken? Even less related but we still share a fair amount of genes, they're still chordata, which means they have a spinal column. Human and a frog? Still animals, we still share some DNA. Human and Wheat? Totally different biological kingdoms, plantae and animalia yet remarkably, we still share some genes. Every living thing today is interelated to one another. We all come from one common ancestor.

So, thats just one proof that evolution occurs, the similarity in DNA sequences.

Here i showed one example of evolution taking place right infront of our eyes -

Some more here - https://en.wikipedia.org/wiki/Common_descent

https://en.wikipedia.org/wiki/Evidence_of_common_descent

I highly suggest if you're interested you at least read the wikipedia articles but the book is a very good place to look.

Share this post


Link to post
Share on other sites

How does evolution explain the occurrence of homosexuality?

See the problem with evolution is that it has too many holes.

If evolution had no exceptions (like the laws of gravity), then I would accept it.

Share this post


Link to post
Share on other sites

Ok it's nice that you darwinists seem to think you've got proof on this..and yes I will genuinely research on this topic with all my ..uhm power? and I will come to a conclusion..

but again, you guys seem to shut up when I say that the Quran is the ultimate proof you keep saying we got proof.. but you cannot have 2 theories propagating then one has to be at fault, at least agree with this? Then if one is at fault, and the other is perfect in all its essence, then everything other is at fault. Yes, the Quran and science go together..who do you think created everything? ..so he created everything, and scientists only try to know the WHY part. While they fail to acknowledge the WHO-part. So I will stick with my claim that it darwinism is at fault because the Quran is the ultimate proof. We are not living in the past with the Quran but in the present, because it's still funny no one has still refuted it, and scienctists HAVE refuted darwinism..lots of them. I'm not gonna elaborate furhter on this, cause it seems you don't get the thing that when I say: Quran, then you say NO QURAN..that doesn't make sense..cause the Quran is the only proof for non-scientists to refute darwinism. I don't need to do research, even though yes I am going to. Not for you guys, but for myself..

And the part that is edited about me: I DIDN'T MEAN IT OFFENSIVE..I'm not a native english speaker..it was more sarcastic?? I hear it a lot on television, american tv lol..so if it was offensive taken then forgive me for it ;)

btw, God doesn't hate scientists..that doesn't make sense..greatests scientist was a Muslim: Imam Jafar (as) ..but that's another discussion etc etc..

(bismillah)

(salam)

If you are not a scholar of the Qur'an and its tafsīr and you are not a scientist who has studied and researched evolution, then how on earth can you be so confident that:

1. The Qur'an and evolution conflict

2. That evolution has no evidence

I don't need to do research, even though yes I am going to. Not for you guys, but for myself..

It is imperative that we research things before coming to conclusions. There is no such thing as "no need to research".

(wasalam)

Baka likes this

Share this post


Link to post
Share on other sites

Okay, we are in agreement that our DNA is changing/ mutating etc.

I don't quite see how that translates to being "not adaptation if our dna is ever mutating."

But please continue.

sure, now i havent read the massive text box that pomba posted, but i assume he got into this. When you adapt, its certain alleles being promoted as...im trying to think of how to say this. Its...like when you have a dominant and recessive gene, an environment can bring out traits that are already within your genes. Thats adaptation because you arent evolving new DNA nor traits, youre just using what you already have within you.

For example if one grand parent had red hair and one had black hair, then both your parents had black hair, then you had red hair...you would be drawing from traits that have been in your family lineage for generations. But thats not the same as you evolving red hair. Thats the work of genes already within you, not the creation of new genes. So when your DNA mutates, thats new genes, thats new genetic traits coming into your DNA. And DNA sequences for your proteins which manipulate your morphology. So if your DNA mutates, we arent dealing with adaptation, were dealing with mutation, and when a mutation is selected for in an environment, then you have species evolution...or "speciation".

Adaptation = same genes, different traints

Evolution = different genes, different traits

Çåá ÇáÈíÊ likes this

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

If you are not a scholar of the Qur'an and its tafsīr and you are not a scientist who has studied and researched evolution, then how on earth can you be so confident that:

1. The Qur'an and evolution conflict

2. That evolution has no evidence

(wasalam)

yea exactly, theres the issue right there, he seems to believe there is a direct conflict between evolution and the Quran, which i would say isnt true.

Baka likes this

Share this post


Link to post
Share on other sites

How does evolution explain the occurrence of homosexuality?

See the problem with evolution is that it has too many holes.

If evolution had no exceptions (like the laws of gravity), then I would accept it.

I want to respond to you, but i want you to recognize the initial points being made first. Often people will see something and they will just say "well if B doesnt make sense, then A must not be true". Well, i want to see you say "ok A appears to be true, now what about B". I want to know that we are on the same page with basic concepts. We have to establish that evolution occurs (in one way or another), before we can ask questions like, what about the evolution of sex. You cant ask about the evolution of sex if you still have yet to recognize the process in general.

That would be like me asking for an explanation of the history of Islam without even first acknowledging the exstance of Muhammad. You gotta start from the bottom and build your way up.

Share this post


Link to post
Share on other sites

How does evolution explain the occurrence of homosexuality?

See the problem with evolution is that it has too many holes.

If evolution had no exceptions (like the laws of gravity), then I would accept it.

I think you're taking the wrong approach. Even if you find a few things that we can't fully understand using evolution yet it by no means nullifies the theory. The evidence for evolution is overwhelming. It is most definitely a fact. The genetic sequences alone prove this. Not to mention the experiments where we've seen bacteria evolve right in front of our eyes or the evolution of drug resistant TB or HIV. Same with skin colour, if Adam and eve were the first two humans, they could only produce a certain range of coloured children, nowhere near the variation we see today. The evidence is extremely strong. So, when problems like this show up the solution isn't to throw a very correct theory out the window, it’s to work on how we can find an explanation using evolutionary biology.

I'm happy there’s problems because it means we're still making progress and the theory is getting more refined and comprehensive day by day. It’s very rare an idea in science does not change or evolve otherwise you have static dogma which is exactly what science isn't. Evolutionary theory has been refined ever since the time of Darwin. Darwin realised things evolved but he had no idea how this change was passed on. It was only when gregor mendel (a catholic monk) working on pea plants discovered modern genetics that we could understand how these variations are passed on. There was a problem and we overcame it. This has happened many times.

I always find it bizarre that people don't have problems with any other "theories" like gravity or have any problems when any other ideas have holes, like the higgs bosson in the standard model of physics. We don't yet know if it is or isnt there and yet i dont see anyone here using this to decry the idea or even caring about it or science in general. It's only when there’s some perceived conflict against it that’s when people start to go on a crusade against it. There are plenty of holes in other theories (https://en.wikipedia...lems_in_physics / https://en.wikipedia...ms_in_chemistry / https://en.wikipedia...ms_in_economics).

It seems you want to have your cake and eat it too. I often see people around these forums claim homosexuality isn't caused genetically and it is a free choice, so people are morally culpable for it. In case you didn't realise, our genes don't determine our free choices and will for the rest of our lives; If you do believe its purely genetic and subject to evolution, then they aren't morally culpable for being homosexuals. You have to choose one position, you can't argue for both.

Evolution only acts on inherited genetic characteristics. If you lift weights during your life and become very big and strong you don't pass that onto your children because it is an acquired characteristic. Same with someone who decides to be a socialist, it’s not passed on to your children. If you were born with red hair though or a gene that causes depression that might be passed onto your children.

This is why if according to some homosexuality is indeed a choice, it can't be an inherited characteristic, so, its not subject to evolution.

Either its caused by genetics solely and this causes your supposed problem with evolution but if it isn't their choice you can’t hold them account to it, they are not morally culpable then.

OR

It's a free choice and if we have the freedom to make that choice the then it isn't determined by genes and isn't subject to evolution, so, your problem with evolution disappears and they are morally culpable.

So, you either have to pick a fight with evolution but accept homosexuals can't choose their actions or say homosexuals can choose their actions but drop your claim against evolution. I'll hand this one back to you.

So first you need to figure out where you're coming from in regards to that issue.

It skipped my mind before but i just thought i would add it since people might find it interesting. I mentioned before that you have the genes to make teeth in every piece of DNA in your body, same with hair, same with everything. It's just regulated so all these genes don't "turn on" in the wrong places. Cancer is your own cells spreading past where they should go and they have defective genetics and cell death mechanisms. Theres a certain kind of tumor where this regulation is disrupted and you can actually grow teeth and hair inside this particular tumour (https://en.wikipedia.org/wiki/Teratoma).

====================================

====================================

====================================

I think a lot of confusion is going on here too. I think people are equating evolution with the common ancestor of humans being apes.

Evolution is the idea the entire population of a species (individuals never evolve) undergoes a change in genetically inheritable characteristics over time via natural selection. That is they change or evolve. This applies to everything that is alive, like in my example above of drug resistant HIV or the bacterial experiment.

Humans having apes as common ancestors are one example of natural selection, speciation and evolution occurring but it is not what evolution solely is.

So, i think people really need to clarify what exactly they have a problem with. Do you have a problem with the idea of evolution as a whole or just based on a literalist interpretation of the quran you take some offense in the fact that our common ancestor looked like an ape?

I've been on the defensive here but i think its time to throw the other side on the defensive, you are all so keen to point out minor side problems in a theory that is well grounded in evidence. We have seen evolution take place in front of our eyes. Any small problems or unexplainable things are just things that are waiting to be explained.

Creationism has numerous problems with the very foundation and fundamentals of the hypothesis that God created everything and us.

Challenge to creationists

There are numerous problems with following a creationist ideology:

1. For one, as i have shown in this thread (or perhaps another, cant really remember) all humans are related through a female and a male. This would imply an Adam and eve, except for the fact this man and this woman lived something like one hundred thousand years apart. This is an incontrovertible genetic study, the genetics don't lie. If you follow everyone’s fathers grandfathers, great grandfathers, great great great grandfathers...eventually you reach a point where everyone is descended from the same man. Exactly the same for females.

I explained this in some detail. There were obviously other humans around at this time and other females around at this time but for one reason or another all their lineages died out (not hard to imagine, killed/diseased/infertile/eventually one of their descendants didn’t have children/ect. I explain it at some length, can't remember exactly where but it was on these forums. If you feel the need try find it, if you can't I’ll do my best.

This is a hugely significant problem to the very fundamentals of that adam and eve were the first humans and were the only two around. This is one of the pillars of the idea if you want to be a literalist about it, unless you want to be interpretative but then, literally anything could stand to interpretation.

(In lieu of finding my explanation this might help - http://biologos.org/questions/the-mitochondrial-eve / https://en.wikipedia.org/wiki/Y-chromosomal_Adam / https://en.wikipedia.org/wiki/Mitochondrial_Eve

2. Creationism is the position God created the species as they are, unchanging.

I have quite clearly shown things like bacteria and HIV evolve. You can find many other examples of evolution.

Back to Adam and eve. The genome of a person can only contain so much variation. If adam and eve were the very first two people (if you are a literalist) they could only produce offspring with a limited amount of skin colors. Since their genes cannot undergo change (this implies evolution), how are you to explain the wide variety of differing skin colours? Not only skin colors but many other polygenic traits like eye colour, hair colour, hair texture, penecillin allergy, lactose intolerance, ect.

In addition to this variation that would be impossible to explain, all genetic diseases as well. They are passed on through genes after all.

So, either Adam and eve had every genetic disease known to man (very hard to believe) or somehow there were more than 2 people around or these diseases later evolved.

Things like hair colour and skin colour are impossible to explain, we can only have two variants of a particular gene.

You don't see a white couple spontaneously producing a black child for instance or vice versa. You don’t see two red head parents having a child with black hair;

If you at all acknowledge genes can change, rather than the static model of creationism, you automatically must accept evolution.

3. The pieces of evidence above (the genetic sequence comparisons that prove evolution) and also the experiment with ecoli, evolution quiet clearly happened there, how do you explain that? Either you say their genes didnt change and they didn't evolve (seems like an impossible position given that they did) or say everything but humans evolve.

IF you take the latter position though, you are at a loss to explain my first 2 things. You also have to answer why everything else evolved and still continues to evolve and yet we don't. Even though we have DNA like those things do and we experience selective pressure like those things do. Speciation quiet clearly occurs all across life, if you accept things speciate, why couldn't apes speciate into humans?

4. Any other human variation and recent human evolution.

https://en.wikipedia.org/w/index.php?title=Human_evolution&oldid=472630015 - Scroll down to the recent human evolution section.

For example, the natural selection and subsequent evolution that occured when the black death swept through europe (http://www.forbes.com/sites/stevensalzberg/2011/09/02/the-black-death-is-dead-thanks-to-evolution/ ).

Another case: I've also written about this somewhere here in great detail. Sickle cell disease is debilitating. In genetics we have two copies of each gene, so we can have up to do variations. I'll use S and s (upper and lower case) to represent the no sickle cell and sickle cell disease variant respectively. So, someone with no sickle cell would be SS. Someone with full blown sickle cell would be ss and someone with mild sickle cell would be Ss.

In the normal person, both gene "recipes" lead to the production of fully normal red blood cells. In a person with ss, all their blood cells would be malformed and they would be quiet ill. In a person with Ss though, half their blood cells are normal and half are malformed.

The person with a mild variation still has enough normal blood cells to function in most cases just as normally as any other person with SS.

Malaria is a debilitating disease rampant in Africa.

It just happens that people with sickle cell disease are more resistant to malaria than normal people. Their malformed blood cells are much harder for the parasite to get into and infect. Malaria is obviously a pretty bad disease and natural selection knocks out those who are less "fit" (in a biological sense, less adapted).

The full blown sickle cell ss, makes a person much too sick. It isn't a good trade off, even if you're resistant to malaria you're very sick anyway.

A person with SS is totally normal but more susceptible to malaria.

Both of these are less than optimal and won't be selected for by natural selection. People with these variations are less fit and will die more often, sooner and have less offspring and pass on their genes less in the long run because they are not as well adapted.

However, people with Ss are something very special. The mild sickle cell disease doesn't hurt them all that much (or at all in most cases) but at the same time they're also resistant to malaria. This is obviously the optimal condition if you live in an area where malaria is present and you genes will be selected for.

Is it just a coincidence that in the areas with the highest also have the highest prevalence of the Ss mild variation of sickle cell disease which confers some resistance to malaria?

If you live in an area without malaria, there is no advantage to having mild sickle cell disease and resistance to malaria. There is no malaria present. So, people from northern Europe and indigenous populations of Australia for example have a very low prevalence of this gene, much less than these African populations.

That is natural selection in action and that is evolution in action.

Genes have obviously changed and evolution has occurred.

Do you deny this?

For more info (https://en.wikipedia.org/w/index.php?title=Sickle-cell_disease&oldid=472511173)

If you accept we evolved here then you can't automatically deny we could of also evolved from apes. If evolution takes place here, why not in apes?

5. Is it just by pure coincidence as we move through the fossil record organisms get more complex and the newer organisms resemble in many ways (anatomically, genetically, functionally) the organisms in the lower strata?

6. Why are certain animals and certain plants in certain places?

All the continents on earth use to be joined together into one super continent.

If God created kangaroos at the begging, why are there not kangaroos everywhere? Surely they eventually moved to the other parts of this supercontinent. Same with koalas and countless other life forms.

7. Why do certain kinds of organisms only appear at certain stages in the fossil record? Surely, God created all the animals at once and all the plants at once. Unless he was continuously adding new animals but this implies he did not do a perfect job in the first place if he had to edit anything and as an all-perfect being he is unable to perform an imperfect action.

First we only see things like bacteria’s. Then come in the marine animals and nothing else. Then we get dinosaurs. Later things like horses and sheep appear for the first time then finally humans.

How do you explain this, especially in regards to what i was saying above about perfection?

8. So, God is a perfect being. As a Muslim you must accept this. It is impossible for a perfect being to do anything imperfect. Every single thought, intention, and action that is set into motion also will be perfect since God knows everything, is all-powerful, and is perfect. It is impossible for God to willingly carry out any imperfect act.

Why are we not perfectly designed then? We have numerous flaws.

Our eyes have a blind spot, all mammals do. Animals like octopus' don't though. In-fact, you can even do a little experiment and find your own blind spot using this page - https://en.wikipedia.org/w/index.php?title=Blind_spot_%28vision%29&oldid=468771340 .

This is an imperfection, it might be excusable if it was present in everything but other animals eyes in regards to the blind spot are obviously more perfect than ours.

We have knees that are prone to dislocating, due to our nature of being bipedal and upright but not perfectly made we are prone to numerous back injuries.

Our spinal cord is such a vital part of our body and yet one simple break and you're entire body is useless, if it was perfectly made why not include much more protection?

We have wisdom teeth that erupt later on in life and yet we have insufficient room in our gums for these teeth, they push other teeth around, explain something like this?

If we were truly created by God none of these imperfections could be present unless you contend God is imperfect or able to produce flawed things.

9. I won't bother retyping it but if you look in my above posts, i mentioned how diseases caused deaths of billions and billions of innocent children. Children that cannot sin and cannot be judged. If you do not believe in evolution and believe God created everything, then, God must of created these diseases. (Refer to my more comprehensive post on this before you answer).

These were not pleasant deaths either, they are slow and excruciating.

Right now around the world children, have worm-like parasites boring into their eyes. If God created everything God must of created these parasites, how do you rationalise the creation of these parasites with an all loving God?

What about horrible diseases like smallpox? They killed many many children and yet us humans eventually got rid of them. We abolished the very diseases God instituted upon us. Why even bothering instituting them in the first place?

These are challenges to the very fundamentals of creationist ideology. If even one of these is lacking an answer, your entire position becomes untenable.

Çåá ÇáÈíÊ likes this

Share this post


Link to post
Share on other sites

sure, now i havent read the massive text box that pomba posted, but i assume he got into this. When you adapt, its certain alleles being promoted as...im trying to think of how to say this. Its...like when you have a dominant and recessive gene, an environment can bring out traits that are already within your genes. Thats adaptation because you arent evolving new DNA nor traits, youre just using what you already have within you.

For example if one grand parent had red hair and one had black hair, then both your parents had black hair, then you had red hair...you would be drawing from traits that have been in your family lineage for generations. But thats not the same as you evolving red hair. Thats the work of genes already within you, not the creation of new genes. So when your DNA mutates, thats new genes, thats new genetic traits coming into your DNA. And DNA sequences for your proteins which manipulate your morphology. So if your DNA mutates, we arent dealing with adaptation, were dealing with mutation, and when a mutation is selected for in an environment, then you have species evolution...or "speciation".

Adaptation = same genes, different traints

Evolution = different genes, different traits

Fair point. I'm busy reading something on the subject and I'll return to you on this in-depth.

Share this post


Link to post
Share on other sites

How does evolution explain the occurrence of homosexuality?

See the problem with evolution is that it has too many holes.

If evolution had no exceptions (like the laws of gravity), then I would accept it.

(wasalam) (bismillah)

Well there is a reason homosexuals are not in abundance :P . Sexuality is not separated in to alleles so basically homosexuality is not completely genetic (genetics may have a factor), there are many environmental factors that contribute to it. A person with hetero parents could potentially have a homosexual child (god forbid).

Share this post


Link to post
Share on other sites

Fair point. I'm busy reading something on the subject and I'll return to you on this in-depth.

Sure, also id like to add that these mutations have been observed in animals including humans to have manipulated the actual bone structure of organisms. Which, ill just put on the table to minimize the potential response you may give.

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

To Najib

I don't need to be a top scholar to understand the following ayahs:

  • 2:117- The Initiator of the heavens and the earth: to have anything done, He simply says to it, "Be," and it is.

  • 3:47- She said, "My Lord, how can I have a son, when no man has touched me?" He said, "God thus creates whatever He wills. To have anything done, He simply says to it, 'Be,' and it is."

  • 6:73- He is the One who created the heavens and the earth, truthfully. Whenever He says, "Be," it is. His word is the absolute truth. All sovereignty belongs to Him the day the trumpet is blown. Knower of all secrets and declarations, He is the Most Wise, the Cognizant.

  • 16:40- To have anything done, we simply say to it, "Be," and it is.

  • 19:35- It does not befit God that He begets a son, be He glorified. To have anything done, He simply says to it, "Be," and it is."

  • 36:82- All He needs to do to carry out any command is say to it, "Be," and it is.

  • 40:68- He is the only One who controls life and death. To have anything done, He simply says to it, "Be," and it is.

If you are using these "Be and it is" verses to disprove the "evolution of species", then you are doing a very bad job.

This just shows that you have to be more familiar with the Qur'ān before you can understand those verses. God also says:

Your Lord is
Allah
, Who
created the heavens and the earth
in six days
and then settled Himself firmly on the Throne... (Qur'an, 7:54)

6:73- He is the One who created the heavens and the earth, truthfully. Whenever He says, "Be," it is.

Are you suggesting that "Be" and "it is" means "it takes no time"?

So why did the heavens and earth take six days (and according to a lot of scholars, six time-spans) to create?

21:30
Have not those who disbelieve known that
the heavens and the earth
were
of one piece,
then
We rented them asunder

6:73- He is the One who created the heavens and the earth, truthfully. Whenever He says, "Be," it is.

Are you suggesting that "Be" and "it is" means "it does not evolve"?

So why did the heavens and earth evolve from being one piece to being parted and rent asunder?

------

The above is ample proof that you need to be more familiar with the language of the Qur'ān before giving out judgemental fatwās. "Be and it is" does not mean "it springs fully into being in one moment" nor does it mean "it is created whole and complete". In fact, all the Qur'anic evidence shows that "Be and it is" unfolds in time and undergoes change.

I really recommend that you do research before you judge. Research is necessary. Judgement before knowledge is dangerous and blind.

Don’t follow that of which you have no knowledge. Verily the ear, the eye, and the heart, each will be questioned. (Quran, 17: 36)

(wasalam)

(wasalam)

Çåá ÇáÈíÊ likes this

Share this post


Link to post
Share on other sites

Sure, also id like to add that these mutations have been observed in animals including humans to have manipulated the actual bone structure of organisms. Which, ill just put on the table to minimize the potential response you may give.

Okay, I'm interested here. Please elaborate.

Share this post


Link to post
Share on other sites

Salam-How about the possibility that evolution, as we so far understand it, happened, but at the point where 'humans' finally develpoed the needed mental capacities and what not, it was at THAT point God 2 of them soul/spirit, thus creating Adam and Eve, the 'first humans'? This possibility allows for the explaination of the large numbers of humans present that would have allowed for a viable gene pool...Just a thought.

Share this post


Link to post
Share on other sites

(wasalam) (bismillah)

Well there is a reason homosexuals are not in abundance :P . Sexuality is not separated in to alleles so basically homosexuality is not completely genetic (genetics may have a factor), there are many environmental factors that contribute to it. A person with hetero parents could potentially have a homosexual child (god forbid).

Salam-I just want to add a comment that I was raised on a farm, and have worked numerous years in the field of animal husbandry, and I can attest that homosexuality exists even in the animal kingdom, and it is not simply an alpha male trying to assert his dominance, and likewise with females trying to assert alpha dominance-these animals actually took turns with each other-not one simply being dominated by the other...It is not too common, but it does happen...

Share this post


Link to post
Share on other sites

Okay, I'm interested here. Please elaborate.

This is why i created my evolution topic. Go check it out, its in my signiture.

Check out the Italian Wall lizard paper and the LDL receptor paper.

Mutations have been observed to have changed many things about our physical existance. When you look at a whales fin, it has the same bones as humans, theyre just bigger and have long fingers.

hands.jpg

We all have the same bones, just different shapes and sizes, and mutations in todays time can be seen to change not only things like hair and skin color and tall skeletons and short skeleton humans. Our physical morphology does have limits, but the limits are not within the range of "human" traits.

If you can see that our physical bodies can evolve, then there should be even less of a reason for you to doubt that we are related to something like a whale. Because the whales bones are just like ours. They may be a different shape and size, but u know, our parents bones are a different shape and size too. And our children will be different as well. So over many many generations its understandable to see that a whale and any other mammal could be related (and there are many details im not talking about here).

Like, african and indian elephants. Physically they appear alike, but their bone structures are very different. Yet we just kind of know that they came from the same elephant ancestor. Same with alligators and crocodiles. The same ancestor, but clearly they are different.

So it all comes down to time. The reason humans dont appear to transform into monkeys or vise versa, and the reason we dont grow wings or fins to go swimming, is because it takes a really really really long time. Like, we're talking millions of years.

But in the few thousand years we have been here, we have observed bone density increases in families of humans and in animals like the italian wall lizard, in a short observable time we have observed a shift in the morphology of its skull and organs. And these are just 2 examples of hundreds that could be given.

And there are many other lines of evidence, this is just 1, and i dont expect it alone to convince anyone of anything.

whaleevolution.gif

gomphotheres1.jpg

On both of these if you squint hard enough you can see timelines, and you can see how animal morphology has changed along with time.

All mammals share traits, its what defines us as mammals. And this is why we know that whales are not fish, this is why whales have babies like we do and dont lay eggs. Its because we are closer related, and its simply been a really really long time since weve shared an ancestor with them. (but not as long as its been since our reptile or amphibian or fish ancestor and not as recent as our chimp and orangutan shared ancestors)

Share this post


Link to post
Share on other sites

(bismillah)

(wasalam)

Thanks for explaining, no it does not prove it indeed even though the starting process is with BE AND IT IS. Like Jesus son of Mary (pbuh) who was created by that, and the like of Jesus is like that of Adam, Allah said to it: Be and it is and then Jesus was formed in the belly of Mary .. so then accepting that the Quran in all it's beauty and essence is the Final Word of Allah the Creator and Originator of all things, because it has not been found guilty by mistakes or errors, we can say that it is not contradicting in any sence.

Then see Quran 30:30 - دگرگونی در آفرينش خدا نيست. (FARSI) and فِطْرَتَ اللَّهِ الَّتِي فَطَرَ النَّاسَ عَلَيْها لا تَبْدِيلَ لِخَلْقِ اللَّهِ in ARABIC. So I hope you guys understand this a little bit it says: There is not alteration in Allah's creation (except in the limits he has given: Yes this part from 'except..given' I typed myself after reading a tafsir)- This is a part of the ayah. You can look it up.

Say: ‘What thing is greatest as a witness?’ Say: ‘Allah. He is Witness between me and you. This Qur’an has been revealed to me so that I may warn you by it, and anyone else it reaches. (Surat al-An’am: 19)

So can someone then bring me another tafsir? I have given you in Persian, Arabic and English. I hope the one who is going to give the tafsir doesn't give me an answer that Allah doesn't mean THAT, but He means : Don't alter yourself, coz then he hasn't understood anything out of the 3 language choices I gave him and he better not reply, because this is the actual meaning and I looked it up just in case. If someone still wants to say that, then I have my reply..but first do some research yourself before saying that..coz it wouldn't make sense and you clearly don't understand the Quran.

Wassalam

Btw, Jebreil you're a Muslim?

(bismillah)

(salam)

I am Muslim, and I've read in Makārem Shīrāzī that - in his understanding - evolution of species and Qur'an do not contradict - although he has misgivings to extend this to human beings - but, if I remember correctly, he was prepared to still believe that physically humans could have evolved from other organisms, but that there was a qualitative leap when the "soul" was breathed. But I'm not sure of that last part; I just think I remember.

Apart from that, there is no doubt that the human body was fashioned out of physical matter (what the Qur'ān calls "clay"), bit by bit, over some period of time. If inanimate, unintelligent, unfeeling, boring piece of clay can become a living, thinking, loving, creative human being by the will of Allāh, then I'm sure there is no problem to believe that a living, feeling, even creative organism can become a human being. Obviously, there has to be some qualitative leap, and there is - humans are the only creatures with intelligent civilisation.

This versepart: لا تَبْدِيلَ لِخَلْقِ الله

"There is no alteration in the creation of God".

What does it mean?

Well, we can look and see what it does not mean:

- It does not mean that clay does not turn into human beings by the will of Allāh.

- It does not mean that sperm can fertilise an egg and develop into a human being.

- It does not mean that human beings cannot change through environmental changes (e.g. look at Chernobyl biths)

- It does not mean that human beings do not genetically change (e.g. how can a single-coloured Adam be the father of blacks, whites, reds and yellows, unless genetic change was possible?)

- It does not mean that a clay-bird cannot miraculously be breathed to life.

- It does not mean that living things can be brought out of water (Have those who disbelieved not considered that the heavens and the earth were a joined entity, and We separated them and made from water every living thing?)

All this alchemy of the world, changing one substance to another, extracting new properties from old properties, is the miracle of nature, the signature of a creative God.

Evolution does not conflict with the Qur'ān.

Whether it's true or false for scientific reasons, it's another matter - but Qur'ānically, it doesn't appear to be false. Every day we see creation renewing itself, the rising of the sun and the moon and their setting, the tides and the floating plates of the earth, the gathering clouds, the blowing winds, the hailstorms and bouts of sleet and snow. Yet, it all happens upon the natural logic of order and harmony and law. Why shouldn't we suppose that this is how it has always been: the beginning of the world, the formation of the earth, the creation of the first living thing, the multiplication of organisms, the changes in climate and environment, the "first human" where a qualitative leap probably occurred, etc?

Of course, I am suggesting this - but I emphasise that before we make strong judgements from Qur'ān on Evolution, we must have a good grounding in the Qur'ān and a solid understanding of the claims of Evolution. Until then, we must suspend judgement.

(wasalam)

Çåá ÇáÈíÊ likes this

Share this post


Link to post
Share on other sites

Riiight..and Imam Ali (as) knew in a SPLIT SECOND the answer to which animals lay leggs and other's give birth:

One day another (Jewish) person came to Imam Ali (as). He was planning to ask Imam Ali (as) such a question, which would take Imam Ali (as) a long time to answer and because of that his Maghrib Prayers would be delayed.

He asked, "Imam Ali you say you know everything in the world, then tell me which animals lay eggs and which animals give birth to their young ones."

Imam Ali (as) looked back at him- smiled- and said, "The animals who have their ears outside their body give birth to their young ones and the animals who have their ears inside their body lay eggs."

So if you see that all animals who have their ears out give birth and the ones whom you can't see the ears of lay leggs..

Dolphins have ears inside of their body and they dont lay eggs. Well that was simple enough...

The outer ear is a product of mammal evolution. But please dont ignore all of the other things i had previously said.

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

To Najib

Makārem Shīrāzī knows enough tafsīr when he says that evolution of species in itself is not conflicting with the Qur'ān.

And capital letter LOLs is very immature.

(wasalam)

Share this post


Link to post
Share on other sites

First of all, LOL that everyone just ignored my post about the white baby from black parents - it's such a blow to evolution.

In order to pose an argument against anything, you will need science. A random internet news article wont get you anywhere here.

Share this post


Link to post
Share on other sites

Also, dolphins do not have ears on the outside of their head, nor do they lay eggs. Neither do whales.

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

To Najib

If you want a mature, serious discussion, be more respectful:

You definitely didn't understand the verse and it's real meaning, sorry so go and do some real research and don't misguide people from Allah's way if you are truthful. If you are a Muslim then don't go against me if you yourself don't know anything about tafseer. You will be held accountable for it.

Anyhow, I'm giving a guess, and assuming you know Fārsī:

http://fa.wikipedia.org/wiki/%D9%86%D8%B8%D8%B1%DB%8C%D9%87_%D8%AA%DA%A9%D8%A7%D9%85%D9%84

Check the bit about "Evolution and Islām", then check those who accept Evolution, those who reject it, and those who suspend judgement because of what they see to be lack of evidence - the actual sources can be found cited at the bottom of the Wiki-article.

Please be more careful before giving out heavy fatwās, unless you happen to be a mufassir of the Qur'ān or a scientist on Evolution. Given the lack of religious consensus on this issue, and given the stronger scientific consensus for Evolution, I would suggest, at the very least, to suspend judgement.

(wasalam)

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!


Register a new account

Sign in

Already have an account? Sign in here.


Sign In Now

  • Recently Browsing   0 members

    No registered users viewing this page.