HassanShia

Evolution And Islam?

Rate this topic

214 posts in this topic

Darwin's theory of evolution seems to convince people that species evolve over time to adapt to the environment etc. Now that does seem like a logical explanation and can be shown in us humans by our skin colors. Anyway Darwin said that we evolved from apes and scientists have found evidence to back this up such as Ardi's skeleton etc.

Then Islam says that Adam and Eve where the first humans and were sent down from HEAVEN. So this means that we cant have evolved from apes as Darwin states because Adam and Eve where the first humans.

But then again what hit me was the fact that if Adam and Eve where the first and only humans on the planet. So they reproduced and had kids. Now according to science if people who contain the same genes and reproduce they will form deformed babies. (There might be an explanation to this but I am not entirely sure).

So it goes on and I can't seem to find an explanation on what to believe in, both, or just Adam and Eve being the first humans.

Any detailed explanations would be great, and sorry if I made any wrong statements in my post.

Share this post


Link to post
Share on other sites

Well, scientific principals don't really need to "convince" anyone, they are there to establish the truth and reality of the workings of the natural world.

(Just as a side note i actually wrote something for university on the evolution of skin colours if you are interested in such a topic)

We didn't actually evolve "from apes". Apes didn't spontaneously change into humans, if they did, why are there still apes around? We shared a common ancestor with apes. We've covered this many times in the science/technology section so you might want to look there or google "common ancestor".

I'd just like to first have to state science and religion don't have to be contradictory or in conflict. You can have your cake and eat it too. Science isn't about establishing a religion or beliefs, its just about facts that are independent of religion. For example, evolution does happen quite clearly but we still don't know the origin of life, you could slip in God there if you so choose or perhaps say that God guides evolution (this would raise other problems though, like why did he allow disease to evolve).

I'd also like to say, in science, we don't take things as unchangeable, like faith documents. Darwin was the originator of a lot of this and had some good ideas but he had a lot of wrong, outdated ones too. We've moved on since, progressed and fixed this up. It's not at all about unchanging dogma. So, i wouldn't place all my stock in darwin, the idea as it stands now is so much bigger than just darwin.

Almost everyone actually has the same genes. We all have a gene for hair colour. What makes is different is variants in these genes, these variations are called "alleles". It's these alleles that cause problems, because we get our genes from our parents, related people are quiet likely to get the same alleles. There are some disease that only occur when two rare alleles come together, this wouldn't happen in the normally mixed population but between related people who share a lot of alleles, it could quite easily happen. It's not a totally sure thing though but it does happen fairly often. So, its more of a chance of it happening, not a sure thing.

If you want to take an view, you could say God created adam and eve with varied alleles so this disease didn't happen in their immediate children (the first generation). Some may say though, this is just trying to patch up an "obviously" (according to them) "damaged" idea. It's up to you to make up your own mind. However, if these were the only humans, the children of adam and eve would of had to interbreed with each other. Even if eve had different genes to adam, the children got all their genes from adam and eve, so the children would all be similar to each other. So, the children of the children (in genetics F2, generation 2) run the risk of serious disease.

I guess if you wanted me to formulate some kind of apologetic for it, you could say that adam and eve were the first humans but later on, other humans evolved independently as well and these humans mixed with adam and eve's children to get what we see today.

This has some problems though, for example, its extremely unlikely humans would naturally evolve to be an exact match and be able to breed successfully with the humans God created. The chances of this are so mind boggling astronomical and huge (i'm talking over 10 0's) that assuming it just simply happened this way is a lot more silly than assuming that this didn't happen.

Another explanation could be Adam and Eve were the first humans and God "guided" evolution to make sure humans later split off from the apes and evolved but...why is this needed at all then? If he created adam and eve and they came down from heaven, why couldn't he do this for everyone else... or alternatively, if everyone else evolved, why couldn't adam and eve just simply evolve as well?

You can think of it like a tree, You and your relatives are closely related, you branch off very close to the end of the tree since you're so close. Two ethic greeks who are unrelated in most ways, still would most likely come off the branch, just not as close to the end, they're more distantly related. Me and you? I'm not sure what your background is but i'm a very strange mix, so i doubt we're the same, we branch off even later but we're still on the same branch!

They took DNA samples from a lot of people and figured out that everyone is all distantly (very very distantly) related to each other. This person could be considered the part of the branch that attaches to the tree and this is the main branch, which smaller branches come off of. This person wasn't the only person around at the time but ever living human is related to this person. The other people around at the time, their lines probably died out at some point. They were infertile or killed before they could have children or just didn't have children, ect.

Now, i'm sure you know females have two X chromosomes, XX. Males have one X and one Y, XY. Now, where must the Y in a male come from? Why his father of course! His mother doesn't have any Y's to give him. So, a males Y chromosome descends in an unbroken line, from his father, to his fathers father, fathers fathers fathers ect..

Same with the X chromosome. In the case of males, it comes from your mother, so your mothers mother..mothers mothers mothers...ect.

You reach a point where everyone is related to a single person in distant history. So, we all share the same extremely great grandmother and extremely great grandfather. People have named these "Y chromosomal adam" and "mitochondrial eve". They're just snappy names, they don't imply an adam or eve and like i said there were other people around at that time.

Here's the problem though..They've found through genetic analysis Y chromosomal adam and mitochondrial eve lived apart in time, on the order of hundreds of years at least, if not thousands (more likely). So, this kind of disproves the idea that we all descended from two people who lived at exactly the same time.

Do get back to me on what you think about this though.

(I think its still possible to believe in evolution, like i said, God could of just simply started it off but now i see why so many muslims say they believe in evolution but don't believe humans evolved. As someone who studies this i can tell you there is quite considerable evidence for the fact that we did evolve from other primates at some stage. For example, we can get DNA from a great ape and a human and compare them, they've very similar. More so than a human and a dog for example. Even more so than a human and a frog. Even more so than a human and bacteria. This is because of this - https://en.wikipedia.org/wiki/Biological_classification . For example, we're all the same species. Apes and humans aren't though.

For example:

Humans: Kingdom: Animalia Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Tribe: Hominini Genus: Species:

H. sapiens

Bonobos: Kingdom: Animalia Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Species: P. paniscus

Bonobos are like an ape if you didn't already know. We're in the same things, right up untill we reach the genus and species. In humans its homo in bonobos it's pan but we're still closely related in a way. Take a look at something thats still a mammal for example (look on wikipedia) and see how everything differs after class:mammalia. An elk or a possum for example. Look up a brine shrimp, notice how its very different. They're still in kingdom anamalia (being animals) but everything else is different. They're no longer in the phylum "chordata" which is animals with a spinal cord/backbone. Things like butterflies or worms are also here. So, we're (obviously) very distantly related to shrimp. Take it back even further, lets leave the kingdom anamalia. Kingdom is the highest and most encompassing level. Lets go to kingdom plantae, the plants. We're obviously...very very different..from plants.

There's something even larger than a kingdom though, its called a domain. It's things that are very very different (and sometimes very weird forms of life). At a cellular level their cells are very different to the domain we're in. A lot of these living things are just one single cell, with all the functions needed for their life packed into one tiny little cell. Obviously, we're much much much more different once a again from these things, because of how we differ on the highest order classification.

So, theres just one piece of evidence.

You may also like to look up "abiogenesis" or the origin of life.

Share this post


Link to post
Share on other sites
But then again what hit me was the fact that if Adam and Eve where the first and only humans on the planet. So they reproduced and had kids. Now according to science if people who contain the same genes and reproduce they will form deformed babies. (There might be an explanation to this but I am not entirely sure).

Its not true that having the similar genes will definitely lead to diseased babies. This will only happen if the genes that are passed on include many faulty ones. And even if they do include faulty ones, its by no means inevitable. In any case you dont know that Adam and Eve had similar genes. Maybe God created them with a lot of genetic diversity.

Share this post


Link to post
Share on other sites

I was quite tired when i wrote it and i've now noticed a couple errors (largely in just wording), so i'll take care of the ones i think would of been most confusing.

I also failed to mention some important things and link some other discussions about this in the past.

I think i also got a little too bogged down just providing one piece of singular evidence, so, i'll try remedy that.

First of all though, i'll just link some threads where this has come up in times gone by:

http://www.shiachat....ost__p__2207228 (little more detailed picture of the whole y-chromosomal adam and mitochondrial eve thing and as a bonus prize, my horrible drawing skills)

http://www.shiachat....ost__p__2205142 (A simple yet powerful experiment that shows evolution actually does occur on some level, the rest of the thread after that post covers quite a lot as well)

http://www.shiachat....__fromsearch__1 (Hellfire Toothfairy asked: Why don't non-poisonous creatures display bright colours?)

http://www.shiachat....ost__p__2293058 (some discussion of the evidence and a few book reccomendations)

Could of sworn there was more but i guess i just can't find them.

I know that i can't find them, i have several pictures i remember drawing for these discussions and posting them but they're not in any of the threads i've found.

humevo01.jpg

humevo02.jpg

I think educating people and educating people well is an enormous part of science and i enjoy it as well, so i tend to make a lot of pictures, drawings and examples. I realise it can be all very confusing and hard, it was for me too once, so if you (or anyone reading) does have any questions, feel free to ask.

As for books, if you want a very good overview of the reasons for evolution, i suggest Biology 8th edition by campbell, reece and meyers. You can find it through various methods on google. Chapter 22 in particular.

I was going to mention the views of a lot of religions and people but i think its just better i point you in the right direction and make up your own mind. In instances like this i'm not a huge fan of wikipedia, its original idea was to be accessible for the common person but i can see a lot of their articles have become needlessly technical. None the less, these might help:

https://en.wikipedia...oldid=467796808 (In particular, look for the views of the various religions on evolution, this will probably help you. Eg roman catholic views on religion, theistic evolution, ect)

https://en.wikipedia...oldid=467932800

https://en.wikipedia...oldid=467757578

https://en.wikipedia...oldid=466257293 (This might be particularly relevant, yes, i know ahmadiyaas are considered heretical but doesn't mean you should totally discount every little thing they do either, it's worth a read and i think it'll help you out.)

The evidence for evolution occuring in a general sense is extremly overwhelming. We have bacteria that evolve to become antibiotic resistant for example and the experiment richard lenski conducted that i talked about in another thread. So, we know evolution does occur. We also know humans do evolve. We have plenty of evidence humans evolved from other forms of life as well.

That chapter in campbell reece and meyers really goes into a lot of the evidence and i highly recommend you find and read it.

You could also google "evidence for evolution" if you wanted to but i'd be more cautious of that. Wikipedia has a list but again, i dont think its very accessible - https://en.wikipedia...oldid=464364208 .

--------------------------------------------------

--------------------------------------------------

--------------------------------------------------

I can understand how this must be hard for you though. Besides science philosophy of religion is one of my other main interests, islam in particular presents an interesting thing to me. Unlike the bible and the torah, it is the direct word of God simply written by humans and claims to be all perfect and all correct. Almost all muslims believe the copy you read today is the original. In christianity and judaism though, by in large, its seen to be written by humans inspired by God, recanting events and telling historical stories and parables to teach us things rather than being expressively literal. This obviously brings with it various problems which i won't discuss here. However, it allows them to bend their belief to fit what they see without much problems. However, i can see how this can cause serious problems in Islam. To question it is to question God himself or the errorless quran, so, i do feel sympathetic to the difficulties one would have. Especially in a case like this where it would be extremely hard to reconcile what the quran says with the overwhelming evidence things do evolve and humans did evolve from other animals. Islam hasn't gotten to this point yet but most christians don't think all of the bible is literal and being liberal theologically necessarily isn't a bad thing. The catholic church recently said they accept evolution and the archbishop of the anglican church rowan williams is into a version of theistic evolution (he talks about it on youtube).

-------------------------------------------------------

-------------------------------------------------------

-------------------------------------------------------

Quote

You can think of it like a tree, You and your relatives are closely related, you branch off very close to the end of the tree since you're so close. Two ethic greeks who are unrelated in most ways, still would most likely come off the branch, just not as close to the end, they're more distantly related. Me and you? I'm not sure what your background is but i'm a very strange mix, so i doubt we're the same, we branch off even later but we're still on the same branch!

I meant to say ethnic greeks first of all. In a gist, i was trying to say, you and your brothers and sisters share a lot of your genetics (obviously). People who come from similar ancesteral heritages still share some genes (you need not look further than why a lot of swedish people look the same or african people for example, so this is a fairly obvious thing too). Even at the very end of the branch, very far back, we're all still *actually related*, so i guess everyone is like your cousin or brother or sister in a very distant way.

Quote

They took DNA samples from a lot of people and figured out that everyone is all distantly (very very distantly) related to each other through the same people. These people could be considered the part of the branch that attaches to the tree and this is the main branch, which smaller branches come off of. This person wasn't the only person around at the time but ever living human is related to this person. The other people around at the time, their lines probably died out at some point. They were infertile or killed before they could have children or just didn't have children, ect.

What i'm trying to say is, we all share a *common ancestor* far, far back. I just made it very confusing.

What i mentioned does do a fair job of disproving a literal adam and eve. If they were the first humans everyone should be able to trace back to two people around the same time. I thought of the possibility of either adams line or eves line dying out and this resolving the errors but that would only work if there were other people around adam or eves time to create seperate lines. If adam and eve's lines died out, we would be all dead too, seeing as they were the very first two humans at that time (according to tradition anyway) and we must trace back to them if it was only those two.

If there were more than 2 people around, we can obviously say some lines died out and others stuck around.

Humanity has been reduced to a very small population in the past though (https://en.wikipedia...oba_catastrophe - as little as 1000 breeding pairs).

I think you might find some solace in the fact though that a lot of people now think humanity only originated in one location and preceeded to spread around the world (the "out of africa" hypothesis) whereas another idea was that humans evolved independantly multiple times in different locations around the world.

Still has its problems though, the universe is 13.75 billion years old, the earth is only 5 billion years old and this is where all our action takes place. The only life present on earth on the order of a million years was simple single celled life forms and bacteria. Even thousands and thousands of years before humans we had dinosaurs..plants..other animals. Eventually, very close to present time, humans came about. What was the point of such a big wait? If the earth is meant for us, why wait so long to create us? ect. We covered it here () i was originally going to link the book but in that thread people point out problems, some i believe rightly so, so i think balanced discussion about it is important.

Anyway, happy to take questions from you or anyone else (long as they're serious inquisitve questions seeking information and not merely challenges to evolution or trying to disprove it, science isn't really democratic, neither is the truth, there is plenty of evidence out there for it. Whether you chose to accept it or not is up to you.)

Share this post


Link to post
Share on other sites

There is a system in our human body which can't be simplified. If even one part of it disappears, the human body won't function. I guess, that's enough proof?

But if you want you can watch this video, it's from Harun Yahya and it explains it in 30 minutes. Moreover, he wrote a book of about 800 pages long about how Darwinism is lots of bulls**@#*&(. So here you go:

Here are the Books: http://harunyahya.com/en.m_book_index.php?cId=76

And here are the videos: http://www.harunyahya.com/en.m_video_index.php?cId=76

That should do it for now ;) I'd recommend you watch the movies, so you won't get bored :P - especially #10: A scientific blow to Darwinism - Irreducible complexity

Share this post


Link to post
Share on other sites

Darwin's theory of evolution seems to convince people that species evolve over time to adapt to the environment etc. Now that does seem like a logical explanation and can be shown in us humans by our skin colors. Anyway Darwin said that we evolved from apes and scientists have found evidence to back this up such as Ardi's skeleton etc.

Then Islam says that Adam and Eve where the first humans and were sent down from HEAVEN. So this means that we cant have evolved from apes as Darwin states because Adam and Eve where the first humans.

But then again what hit me was the fact that if Adam and Eve where the first and only humans on the planet. So they reproduced and had kids. Now according to science if people who contain the same genes and reproduce they will form deformed babies. (There might be an explanation to this but I am not entirely sure).

Adam and Eve may have been the first two humans on earth they may not have been. There are 2 theories.

One is they were the first two humans, they had children and those children were allowed at that time to marry and have babies, which was not haraam at that time.

Other theory is that they had children who then married other humans who were already on earth and had children.

Kamranistan likes this

Share this post


Link to post
Share on other sites

Introductory Remarks

First, i don't to be uncharitable or unkind. I don't wish to cause hurt feelings and i've got nothing against you personally.

People spend a great deal of time learning things from the older generations, they are entrusted to guard this knowledge and pass it down to the next generation. That is how society progresses and how the flame of knowledge is kept alive.

As someone who has been educated in these things ( i really don't like to go around saying this, i don't think I’m better than anyone else but i think in this case it is important to mention these things) i think its important to not allow the propagation of false knowledge, especially ideas with an ulterior motive behind them.

There is a system in our human body which can't be simplified.

"There is a system" is so unspecific and general to could apply to anything.

It's a little trick journalists and propagandists use to get people to go along with things but it's quite obviously faulty logic.

Which system is that exactly? You are remarkably unspecific.

If you don't know, do you think you're informed enough to influence someone’s views when you don't have all the basic knowledge yourself? You could be feeding someone wrong information out of ignorance. I would not give you advice on plumbing if i didn't know the basics. You wouldn't ask a chef for medical advice. Unless you actually have an understanding of something, i would refrain from telling people this is true.

If even one part of it disappears, the human body won't function. I guess, that's enough proof?

Saying something is so is definitely not proof, anyone who thinks so is foolish. I could say the sky is green; it does not suddenly transform it into being green. If you say something is true it doesn't make it true unless you can prove it. So, go on prove this please. If you want your idea or your standing to present this as truth to have credibility anyway.

it's from Harun Yahya

I looked into him. Not a scientist, never been trained as one or practised as one. His sole educational experience, a failed interior design course . His book is very sketchy, including trying to prove things using a fishing lure which he says is an animal. He goes by another name as well, oktar.

You're only able to do chemistry if you've been trained to. I wouldn't trust someone who hasn't studied geology to tell me if there will be an earthquake tomorrow, so why is suddenly ok to allow someone without any training to pretend to be an evolutionary biologist or to criticise evolution? Such an idea is ridiculous unless you can prove otherwise.

Opposition to Evolution

==================================================

You don't seem to mistrust science in general. I doubt you'll reject a cure that people like me have worked on and yet you reject ideas like these.

So, its not a mistrust of science in general, i can see that.

You don't like the idea of evolution.

Science isn't theology, it isn't out to prove any particular religious viewpoint, its out to discover the truth. It's secular, secular is different from atheistic.

People commonly equate secularism and atheism but they are quite different things. I'll illustrate with societies, Communist China and Russia for periods of time were officially atheistic, same with Albania. Worship was repressed, believers were harassed, churches were shut down and clergy imprisoned under such harsh systems. We can see the same under certain religious theocratic systems, like the Baha’i in Iran. Secularism is the best system because it favours no one, it favours no religion not lack of religion. It is the best chance we have for ensuring equality of everyone. If we move into any kind of theocratic thinking (atheistic or otherwise) we run the risk of marginalising people. If the state is very secular, the chance of this happening is a lot lower.

Science is secular. It's not at all about belief. I don't see people accusing chemistry or ecology as being motivated by atheism, so why suddenly make the leap to evolutionary biology? We collect the data first and foremost and draw the conclusions from that. As someone who as spent a lot of time on this i can assure you it quite clearly points to evolution. Again, i'm not intending to hurt you or be unkind but that is just the truth of the matter. Likewise, if the data pointed toward creationism, science would of drawn that conclusion.

The truth isn't democratic. Scientists don't hold votes on what we think is true. Just because everyone wants something to be true it doesn't make it so. What is true is based on what evidence we find to support that notion.

Now, that we've established its not science you have anything against, what is it exactly you might have against evolutionary biology? Allow me to speculate and when you do read this you are fully free to reply and i welcome that if you so wish. Also, if you decide to withdraw your position and argument, you are fully free to contact me via PM for more information on this topic.

I think you don't like evolution not because you don't see evidence for it. There are plenty of theories out there that are more lacking in evidence, for example, the big bang is only one of many plausible scenarios. There is very serious work going on to consider the alternatives. I don't see you challenging those. Remarkably, we still don't know the chemical structure of liquid water either, i however don't see you making much a fuss over that or sticking up your hand to become a chemist and try solve it. So, it doesn't seem like its bad science or unsolved mysteries in general you are against. If you really wanted to elucidate the truth in these matters you probably would be a scientist like me.

Why evolution though? I think its partially groupthink , you see a lot of fellow muslims believing that evolution isn't true and you see people preach this idea, so, you are liable to consider it. PI also think you feel challenged by the idea, that we didn't come from God. I have mentioned here and in numerous other places, you can have your cake and eat it too. You don't need to disbelieve in good evidence based science to be a good muslim. You don't need to feel threatened. If anything, people who try put down evolution out of feeling threatened display a profound religious insecurity to me. It seems like they're insecure about what they believe and need to shoot down alternate ideas. Sometimes, at the extreme of this, people have ulterior motives.

Michael behe for example, a lead proponent of creationism has stated his idea is to influence people and change their ideas. You could call it propaganda or brainwashing in a way. He is concerned (and has stated numerous times, i am happy to provide evidence) that evolution leads to a materialistic atheistic worldview. He believes that it lead to a degradation in religious belief and morality. He isn't spreading these ideas because he is fully interested in good science, he is spreading these ideas because he wants to influence people, because he wants to throw a veil over a truth that confronts him. He realises, before evolution, the only reasonable position was God created us. If i was alive back then, i'd probably be a believer too, it'd be illogical otherwise, God was the only good theory of what created the world. We have greatly moved on since and we now have a very well thought out and well proved theory. He wants to force people to believe what he does by discrediting the alternatives, he does have ulterior motives.

Evidence for Evolution and Theological implications of Creationism

It's evident evolution occurs, i don't know if you totally reject evolution as a whole or just evolution in humans. Things do evolve though. We have antibiotic resistant bacteria, they were not resistant to those antibiotics before, they previously killed them but they evolved to be resistant to it. Evolution quite clearly happened here too (https://en.wikipedia.org/wiki/E._coli_long-term_evolution_experiment). If adam and eve were created and no evolution ever occurs, why do we have more than two races? We have at least three distinct looking groups of people.

I study both philosophy and science which makes me a unique and very formidable oppenent as well. For example, if you deny evolution in its totality, in a philosophical sense, you are implicating God in the direct creation of many horrible diseases. Diseases people like me later go on to cure and extinguish anyway. Why create these living, disease causing organisms in the first place? I would feel more comfortable believing they resulted from natural means rather than God inflicting them upon us.

Someone attempted to estimate the number of deaths due to "natural evil" (diseases that we are not immune to by design, ect). It has been estimated that there have been roughly 100 billion humans born on this earth. Here follows an excerpt:

" Microbial diseases are easily the leading cause of death among children. Malaria has probably killed more youngsters than any other single cause, perhaps 20 billion (Finkel 2007). Other top infectious diseases include smallpox, typhoid, plaque, scarlet fever, yellow fever, cholera, influenza, rubella, tetanus, and rabies. The situation is so acute that a microbial war is being waged upon immature humans (Barnes 2005; Demeny and McNicoll 2003). Because their immune systems are immature, infants and children are exceptionally susceptible to being infected and killed; only the elderly are comparably defenseless. In general, diseases kill their victims—who usually remain conscious during much of the symptomatic period and death process—over an extended period of time ranging from days to years, and with ex- treme levels of discomfort ranging up to the highest levels of agony." [Full article (for free for a change) here: gregspaul.webs.com/Philosophy&Theology.pdf ]

We clearly exhibit less than perfect design (would be happy to detail this extensively if you ask). Our eyes have a blind spot, a perfect designer couldn't do this. It's also impossible for a perfect being to create something imperfect, a perfect being couldn't create imperfection. Our knees are prone to arthritis. Our immune system can't fight off many diseases. Either God designed our immune system to be intentionally weak, especially in children or it evolved. Evolution doesn't produce perfect creatures. It produces good creatures. So, either God intentionally weakened the immune system of children, created diseases which he knew would inflict children that aren't even of an age to be judged before they died and allowed them to die OR God made us imperfectly and is less than perfect himself or we are the result of naturalistic means. Make your choice.

I'd like to point out, he had his idea and then looked for things to prove it. In philosophy, this is called begging the question. You start by assuming something is true FIRST then you go on to prove why. This is obviously faulty logic. You prove why something is true first then you go onto state that.

Oktar

He has also been accused of being practising polytheism in this lecture ( https://www.youtube.com/watch?v=WlqA5eQcvX4 ) and been accused of also having an alterior motive for his books.

He has also been charged on a number of criminal offenses related to his organisation. If you look on his wikipedia page it also states he harrased and slandered 6 professors at a university so badly that a judge awarded them money to make restitution for the severity of these things.

He shares the same alterior motive as behe (He attached special importance to refuting the Theory of Evolution and Darwinism[12] because he felt that it had been turned into an ideology used to promote materialism and atheism, and numerous derivative ideologies. He personally funded a pamphlet entitled the Theory of Evolution[9] which combined "mysticism with scientific rhetoric."[6][7] ). True scientists aren't out to do PR stunts or force people to believe. They establish the truth without such questionable motives.

One complainant, a fashion model named Ebru Simsek claimed she was blackmailed.[58], and then slandered as a "prostitute" in fax messages sent to hundreds of different newspapers, TV channels, major business companies, foreign consulates and government offices for refusing to have sex with Adnan Oktar. The judicial process lasted over two years, during which most of the complainants' retracted their claims, repportedly because of threats or bribes from SRF members. As a result most of the cases against Oktar and SRF (his organisation) members were dismissed, with only two members receiving jail sentences for 1 year each.

You can believe in evolution and in religion. It's part of good science in a world that’s moving forward, if you want to remain in previous centuries, unenlightened by present knowledge out of fear that is your own choice. I don't think its wise to tell others its true though if you don't fully understand what you are getting into. Do you fully understand the theory of evolution and have studied it properly? If you have then please forgive me. Just make an oath here and swear it to be true and i will not pester you about it anymore. If you know in your heart you do understand it then you will have no problem certifying such a thing. Unless you're lying here, in that case i would refrain a little. I am also willing to swear that i actually fully understand the theories i am talking about. If you are not confident to though, then its clear you need to take another look at the argument and probably don’t have sufficient standing to propagate an idea you don’t fully understand. It would be like me trying to preach islam.

If you are unable to make such an affirmation and don't understand all the facts behind it, you need to do some more reading. Is it possible you and others didn't even look at evolution because you thought it was the religiously responsible thing to do? Did you just jump straight to creationism. Don't remain in the dark and let others mislead you with sinister motives, look for the truth. If you don't even understand the theory you decry to not be true its a moot exercise.

I don't want to force you to believe anything. I don't intend to lead you away from your religion, infact as a proponent of secularism and liberalism i would happily fight for your freedom to do so. You can reconcile modern science with religion, it is possible. You just need to look :).

===================================================================================================================

One is they were the first two humans, they had children and those children were allowed at that time to marry and have babies, which was not haraam at that time.

Why would this be harram, they weren't related technically were they?

The science doesn't support this idea though. If they were the only two humans alive we would be able to trace everyone back to these two exact people at this exact time. I mentioned this fairly extensively above. Nonwithstanding the fact that they could of just evolved but i'll leave that out of this reply.

Other theory is that they had children who then married other humans who were already on earth and had children.

This one could work though. Assuming they were regular humans just like we are, in a biological sense anyway.

See, cake and eat it too, just like i said.

Share this post


Link to post
Share on other sites

There is nothing contradictory about evolution and Islam, unless you remove God from the equation or do not accept Adam and Eve as the first human couple. I find it embarrassing that so many Muslims like to argue against evolution without knowing what it is. First of all, you should define scientific theory honestly, as opposed to the "it's just a theory" nonsense. Scientific theories are the working assumption for scientists and researchers because the principles contained therein have been identified and observed. We have observed the process of evolution and the fossil record is there for all to see.

There remain a lot of holes in our understanding of evolution, species and even the origins of sexual reproduction. Our knowledge of the natural world is extremely limited, so I'm opposed to anyone shooting down theories or claiming their views are complete and accurate. Islam doesn't tell us to ignore scientific proof; no other religion tells its adherents to strive for knowledge, understanding and scientific inquiry.

Pascal and Çåá ÇáÈíÊ like this

Share this post


Link to post
Share on other sites

Bismillah

Assalam-o-Alaikum

This debate is pretty awesome.

Let me make things clear: Imam Ja'afar ibn Muhammad Al-Sadiq (as) has said:

"Angels have only Intelligence

Animals have only Feelings

Humans have both feelings and Intelligence."

Allah has created our whole entire structure different than Animals or Angel structure. We are different.

Allah did not come up with humans by going through nature's laws, such as Darwin's Theory is based on.

Imam Ali Ibn Abi Talib says in Nahjul Balagha:

"Allah caused an alluvium of clay to be collected from all parts of the Earth: elevations and plains, salt and fresh, and mixed it with water to give it purity. The he kneaded it with moisture until it became fluffy. Then He gave it the form of a Human Body with limbs, organs, joints, and segments. "

"He solidified it until it dried up for a duration of time which he determined. Then He blew into it from His spirit, and it became a Human Being with a mind to think, intelligence to act, senses to perceive, limbs and joints to support him, knowledge to differentiate between right and wrong, and to distinguish taste and smell, color and shape, made of clay and different colors and shapes, and mixtures of hot, cold, wet and solid material."

Reference: Nahjul Balagha, Sermon about The Creation of Adam. Page 37 of the Nahjul Balagha translated by Farouk Ebeid. (some books may vary based on translator, and the page number may be different but the sermon and the text will be the same)

This clearly shows that Imam Ali (as) is describing how Allah created Adam differently, and not by evolution. According to evolution's theory, pieces of clay cannot fly from all around the universe and form a human being. Darwin's Theory basically says that humans were reproduced from an animal ancestor. But that's not true, if you look at Imam Ali ibn Abu Talib's words. Look at Imam Ali, he made it clear and simple.

You guys, don't talk scientifically. Talk with the sayings of our 12 Imams.

We are just going to go from one question to another if we use our intelligence, which is limited.

Ask our 12 Imams, because these imams have a whole lot of knowledge more than us.

This post will make the 'Evolution and Islam' debate come to a resolution.

Inshallah this will help.

And Allah knows Best.

gajarkahalva likes this

Share this post


Link to post
Share on other sites

Darwin's theory of evolution seems to convince people that species evolve over time to adapt to the environment etc. Now that does seem like a logical explanation and can be shown in us humans by our skin colors. Anyway Darwin said that we evolved from apes and scientists have found evidence to back this up such as Ardi's skeleton etc.

Then Islam says that Adam and Eve where the first humans and were sent down from HEAVEN. So this means that we cant have evolved from apes as Darwin states because Adam and Eve where the first humans.

But then again what hit me was the fact that if Adam and Eve where the first and only humans on the planet. So they reproduced and had kids. Now according to science if people who contain the same genes and reproduce they will form deformed babies. (There might be an explanation to this but I am not entirely sure).

So it goes on and I can't seem to find an explanation on what to believe in, both, or just Adam and Eve being the first humans.

Any detailed explanations would be great, and sorry if I made any wrong statements in my post.

I would recommend standing with science on this topic. Not only just standing with science, but studying it and seeing why or how it presents the things that it does. When you use the word science, to me, i consider science, simply observation of reality. So if we substitute the two, you sound like youre saying...

"Now according to observation of reality if people who contain the same genes and reproduce they will form deformed babies. (There might be an explanation to this but I am not entirely sure).

So it goes on and I can't seem to find an explanation on what to believe in, both (Adam and Eve and the observation of reality), or just Adam and Eve being the first humans."..

Think about it.

There are metaphorical ways of understanding the concepts of Adam and Eve.

here ya go, a topic i made some time ago.

Share this post


Link to post
Share on other sites

Its not true that having the similar genes will definitely lead to diseased babies. This will only happen if the genes that are passed on include many faulty ones. And even if they do include faulty ones, its by no means inevitable. In any case you dont know that Adam and Eve had similar genes. Maybe God created them with a lot of genetic diversity.

The problem with this response is, the genetic diversity that exists within humans tells a story that precedes Adam and Eve. Its like, if you were to read a long detailed novel, like lord of the rings or something, and you cut on the movie half way through and said "maybe the movie was just made to have a story that started without explaining anything".

Its illogical to believe Adam and Eve were simply created with such diversity because the gene diversity tells such a detailed logically reasonable and testably explainable story, that you cant really logically ignore it.

For example, we have genes for...lets say building a body that has back problems. Ok we all have back problems, so whats the deal? well, the genes also demonstrate that they used to build a body that wasnt designed to walk on 2 legs. So logically it makes sense that humanity wasnt simply created with bad back genes (no evidence), but rather we were created to walk on 4 legs, and evolved bad backs (genes of 4 legged walkers reside within us).

This is a very simple way of summarizing this. If you have genes that make it look "as if" you have evolved from an animal with a tail, and you look and see that you do have a tail bone (which we do), then logically we most likely came from something that had a tail, as opposed to being created with a small tail for no apparent reason.

If you have genes for extra wisdom teeth (useless and often detrimental), and you have fossils and phylogenetic trees that demonstrate that our ancestors had large jaws, then its more likely that we evolved from large jawed ancestors (which explains why we have useless teeth that cant even fit in our heads), as opposed to being created with teeth that cant fit in our heads.

evolution is logically sound, explanitory and testable.

Share this post


Link to post
Share on other sites

There is a system in our human body which can't be simplified. If even one part of it disappears, the human body won't function. I guess, that's enough proof?

But if you want you can watch this video, it's from Harun Yahya and it explains it in 30 minutes. Moreover, he wrote a book of about 800 pages long about how Darwinism is lots of bulls**@#*&(. So here you go:

Here are the Books: http://harunyahya.co...ndex.php?cId=76

And here are the videos: http://www.harunyahy...ndex.php?cId=76

That should do it for now ;) I'd recommend you watch the movies, so you won't get bored :P - especially #10: A scientific blow to Darwinism - Irreducible complexity

Huran yahya is not a scientist. He is a random person who talks a lot. We, here in this forum are scientists and in all honesty are more credible than he is.

Share this post


Link to post
Share on other sites

There is nothing contradictory about evolution and Islam, unless you remove God from the equation

Which you don't have to. The readers here might want to look into the idea of "theistic evolution". Even if you think God had nothing to do with life occuring, you could still say he created the universe and so, indirectly, created us. Even if he didn't aim to create us, it doesn't make God any less special or divine. It doesn't make him any less God.

The Vatican has issued a statement saying they believe in evolution, so, the pope does. The archbishop of the Anglican Church, Rowan Williams (i think he's a very decent and respectable person, worth looking into) does as well. He's more of the theistic evolution school though. Richard Dawkins briefly interviewed him and they both reached an amicable conclusion. There’s short clips of it floating around YouTube which quickly sums up what he thinks (rowan).

or do not accept Adam and Eve as the first human couple.

It seems the mods have approved like 6 posts at once and at the time of writing the previous posts none of us were aware of the content in the pending posts.

I think this is a little more contentious. Like i said, we can trace our lineage back to two people, two ancestors everyone shares but these people lived thousands of years apart. If Adam and eve were the first people, the originators of the human race, we could trace our lineage back to two people who lived at the same time.

When speciation occurs (in this case chimpanzees eventually speciating in humans, for me, this is one of the very very keys of evolution, speciation, i highly suggest you all read about this, if you only read about one thing it would probably be either this or the experiment involving e.coli) you usually get a population of more than 2. So, we can’t say adam and eve were the only 2 people to speciate from chimps. Just ignoring my previous comment about the lineages, i guess you could say they were the only two that were a couple, legitimately married, or blessed by God at the time or something like that.

I find it embarrassing that so many Muslims like to argue against evolution without knowing what it is.

Likewise, i was arguing with a Muslim friend of mine about evolution. Eventually it came to the point where i asked them if they even knew all the theory or fully understood it, they said they didn't. I challenged how can you deny evolution if you don’t understand it or know all the evidence? They said no matter the evidence they would not believe (I don't think i need to point the flaws with such thinking). I think though, they have softened their position since and kudos to them. To be like that permanently though is just plain misguided.

It does not bother me all that much if people do not believe in it in their personal life. I care a little because I think they are wrong and its an excellent idea but if they’re not in a field related to it they can really think what they like and it won’t impact the rest of the world all that much. Likewise, half the time people believe out of pure stubbornness and no matter how many times I’ve tried (it’s not a lot bigger than 0) they won’t believe no matter what I show them, so, I don’t work terrible hard on convincing them.

The only times i actually mind is when it crosses the line from private to public and they try to teach creationism in schools. Science isn’t democratic, you can only have one truth. We don’t sit down and vote on which one we like best. We find the one that reflects the evidence. Most of the people who demand equal time are not scientists, they approach it from the humanities approach that there are two sides to a coin. Sort of like conservatism vs liberalism or socialism vs capitalism, science does not really work this way (this came up in a recent article I read, I suggest you all read it - http://www.theage.com.au/opinion/politics/science-is-about-facts-not-ideology-20111215-1ow85.html ).

I only bothered responding here because he seemed actually inquisitive about it and not just looking to prove something. Also, I don’t write only for the people I’m responding too, a lot of people find this site via google, I find this site sometimes when I’m looking for islam related stuff on google too. The average person looking to find the answer to a question isn’t as defensive as some of the things that occur here and are more likely to value what I write as well, that’s half the reason why I write anything here.

First of all, you should define scientific theory honestly, as opposed to the "it's just a theory" nonsense.

Oh god, you would not believe how many times i have heard this and had it said to me or even read it. It numbers at least in the hundreds.

Its based on a fundamental misunderstanding of the word theory. Gravity? Thats just a theory too...you could call it the "theory of gravity" just as equally as you could name evolution like that and yet you don't deny gravity because its "just a theory". Same with the idea the earth revolves around the sun, you could call it a theory as well but i dont see people rejecting it on that basis.

A theory doesn't mean "wild guess" or shot in the dark. I suggest anyone who thinks this look into the scientific method.

There remain a lot of holes in our understanding of evolution, species and even the origins of sexual reproduction.

Oh, definitely, i'll admit its not complete and there are holes. The theory of evolution is continious...evolving, so to speak.

Not many theories in science stay static though. Our understanding of what an atom is has changed so many times and we've had so many models. Each time we get a little closer to the truth.

This is exactly what separates science from religious dogma. Dogma is unchanging, fixed. Science is very fluid and changes all the time. We change our views to support what we observe based on whatever new evidence and new ideas come forth. A lot of people on the outside think scientists would be very disappointed to have something they hold dear proven wrong. Whilst i can't speak for all, this prospect is actually rather exciting for most scientists. I would love for a theory to be proven wrong, it means we can work harder, refine it, get a little closer to a glimpse of the truth. A lot find this idea very exciting. It's rare the exact fundamentals are disproven, its more certain things around them but still, good none the less.

I hate when people call evolution "darwinism". On the first hand, i think they're trying to make it seem like an ideology, almost like "communism" or "socialism" or other -isms. It just seems sneaky. On the second hand, it seems to crown darwin as the only person ever to do anything in regards to evolution. Another guy, https://en.wikipedia.org/wiki/Alfred_Russel_Wallace - Alfred Wallace came up with the same idea, mostly independently. It’s also changed a lot since Darwin. Darwin realised organisms change but he didn’t know how this change passed on. It was up to a monk called gregor mendel to figure out the foundations of genetics (which is how change is passed on) and later the two ideas were combined. We have added and refined a lot since Darwin as well. He isn’t some scientific immutable God, so, its fine to progress since Darwin came up with the very basics.

There will always be holes or problems with almost any theory, doesn’t mean we should abandon it. If it looks 99% true, we just need to work to refine it but we still accept it. Unless you can find a very different theory that just as much reflects the evidence also but that really doesn’t happen all that often.

I know they’re often interchangeable to the average person but it kind of makes me cringe every time I read it. We all have the same *genes*. You have the hair colour gene, she has the hair colour gene, your baker has the hair colour gene, your president does, ect. Its rare to totally lack an actual gene. What makes is different is the variations of this particular gene, whilst we all have the hair colour gene, I have the gene for blonde and you for black. These variations are called something else (“alleles” if anyone is interested) [in reality, not many things are down to a singular gene, hair colour is probably caused by upwards of 5 genes at least].

================================================================================================================

================================================================================================================

================================================================================================================

"Angels have only Intelligence

Animals have only Feelings

Humans have both feelings and Intelligence."

I don't intend to be antagonistic or anything but animals have intelligence too. In-fact i'd probably contend the opposite, they have inteligence but not "feelings" if you mean happy or sad.

Allah did not come up with humans by going through nature's laws, such as Darwin's Theory is based on.

I'll put all queries about evidence and science aside for a second. Like i said above, if God used evolution to come up with pretty much everything else, why not just extend it to humans as well? Or if humans were created and designed by God, why not just create and design everything else as well? I know the bible at least claims (if you read it v.literally) that God directly crafted everything as it is and it never changes. The quran might have a similar idea.

You might also like to read about the argument from scale ( ).

I paste a few short sections:

"Why wasn't earth created for some huge time span after the universe began? The universe is ~13.75 billion years old and earth is only ~4.54 billion years old. Why the massive gap? If humans are the pinnacle of his creation and his main reason for creating the universe, with earth being our home, why is there such a huge gap between the creation of the universe and the creation of earth? Also for most of earths history the only life around was bacteria. Even then modern humans are in the order of thousands of years old not millions like all the bacteria and other animals and things. So, if we are meant to have dominion over animals, why is there such a huge gap between creating animals for humans and then creating the humans?"

"“So if we imagine the history of the universe represented by a line which is roughly 24 miles long, human life would occupy only the last inch. Or if we imagine this history of the universe represented by a single year, humanity would emerge only in the last few seconds of the last minute of the last hour of the last day of the year. So for something more than 99.999 per cent of the history of the universe, the very creatures which are meant to be the jewel of creation have been absent from it.”"

I don't want to debate the actual argument from scale here and the time differences and things like that, that’s for another place. I'm just trying to illustrate, that if he did create us, why did he wait so long? Why the big gap? It seems this is more of a result of a (less than perfect natural process) rather than a creator. That argument, if you try to argue anything with it, is fairly flawed. I guess God could of wanted to wait that long if he felt like it but i'm just using it as a illustration here.

People have this idea evolution produces perfect organism or something, It most certainly doesn't. It's not guided by anything, it happens automatically. This is one of the things that most blew my mind about it, its an easy statement to read but it took me awhile to get a full grasp on this. Even if we weren't here and the earth was only composed of one island, the living things on that island would still evolve. If there is life on mars, that life probably evolves too. It happens automatically, just like gravity pushes things downwards on earth. It just happens.

That leads into my second point, if you believe God did create us, what about all our imperfections? I mentioned above how billions (with a B) of children have died from disease. These children aren't even old enough to be judged yet. These diseases would later be cured anyway. Why not make us immune to them in the first place or make our immune system better? Why are we prone to knee problems? Why do we have a blind spot in our eye? Theres a lot of things imperfect about us.

I believe its impossible for a totally perfect being to create something imperfect, even if it strongly willed to. All of its processes of creation, its manufacturing has to be perfect because it is perfect. So, the outcome would also be perfect. Unless the creation is accidentally imperfect (hard to see how this would occur) i don't think an all perfect and all powerful creator could produce something like us imperfect humans, it just couldn't do it.

This post will make the 'Evolution and Islam' debate come to a resolution.

That’s a bit of a premature assumption isn't it :P ?

I don't intend to brainwash anyone into believing and most of the time i have little interest in convincing most people (with exceptions) to believe.

If you think your faith proves the way, there’s not much i can to do touch you. Faith is about believing things despite ever other thing you run into, whilst some of the biblical miracles for example sound farfetched, like parting the seas, they believe it anyway, because they surrender themselves to a higher order. They believe what this supposed higher order tells them to believe (although then you run into this sort of problem - https://en.wikipedia.org/wiki/Euthyphro_dilemma ). So, there’s not really much i can do if you want to take it down that route.

If you are looking for naturalistic evidence and logic (to a certain extent, eg imperfectness ect) to back up your ideas, then i don't know how well that kind of thing will serve you. I personally believe we don't really choose what to believe all that much, we formulate a position based on our current and previous knowledge, along with our emotions/feelings/disposition and environment. Maybe some of the people out there who don't believe just plain don't or haven't see(n) the evidence or absorbed the knowledge on this topic. Maybe they have strong feelings against it and won’t believe either way, I think though, once most people look into it and absorb a lot of the knowledge, they're kind of logically bound to accept an idea like evolution, since their knowledge has changed. This is of course assuming you're not the other kind of opposition i mentioned, then, not much will change you, if you even read these books in the first place. There is quite considerable and sometimes simple evidence that evolution does indeed occur. I think in these cases one would either ignore it mentally or try to find some way around it. A lot of pieces of evidence are incontrovertible though. Like the e.coli experiment for example.

If you want to go just soley on faith thats up to you but if you want to reflect reality and nature, you might look towards evidence and science.

Share this post


Link to post
Share on other sites

OK, [EDITED OUT].. I thought you would instead of writing a one million-word-reply just look at the video and try to disapprove it. It doesn't matter if Harun Yahya is a scientist or not, he's got a whole team. You really think he's alone in what he's doing..think again. So there are two things you cannot prove:

It doesnt matter if Huran has a "team", we the scientists have a community of hundreds of thousands. I will watch the videos anyway, and i assume pomba will too.

The theory of evolution assumes life developed from a "simple" cell but science today demonstrates that there is no such thing as a simple cell.

-Howard Peth

This is like saying, "evolution assumes life developed from a simple compound, but there is no such thing as a simple compound". If you really take time to look at something like a compound, you will notice that, especially biochemical compounds, are not simple. Nothing is very simple out here, not even atoms. So yes, there is no such thing as a simple cell, however in regards to what life is today, for example the complexity of the human body...yes a cell is simple in comparison to an entire body. Think about it. Yes there is no such thing as a simple atom, but in relation to a cell, an atom is simple.

What? No such thing as a simple cell..WOW, got to be frustrating.

not really, no such thing as a simple compound? I study compounds on a daily basis and have been for years. Doesnt frustrate me at all, especially when many people cant do it and they shower me in funds to do it for them. hahaha but its ok, i will teach them, and eventually they will replace me.

Then you start talking about the Quran or something...

How awesome..soo Mr.Pumba, coz I don't have time nor I want to really discuss with you, cause you seem like really blinded and you really don't want to see without a bias..but still I thought let's not the other bro's think you're at the right end. Because WHENEVER the Quran is brought up, atheists, and darwinists seem to shut up, cause it's the strongest and only proof that there is no such thing as monkey's evolving into human beings.. people who say that don't even have ONE, JUST ONE, proof of it..like fish who became land animals..WHERE IN THE HELL are the different stages? Or did they ALL evolve?

Proof of it? Read the topic link under my name, i made it just for people like you. Theres your proof, if you have an issue, then bring it to me, ill be waiting. Fish coming up on land? Tiktaalik. Where are the different stages? Theyre in devonian rocks, read my name! I picked it just for you, and do you know what my picture is? Take a wild guess! Its another intermediate! lol. Where are the intermediates? Theyre dead, they had babies then died millions of years ago, and we are the babies. Alright moving on...then you hash out more insults or something....

And dont try to give me any garbage of "tiktaalik isnt transitional, even though it has wrist bones like a terrestrial animal and muscles that could lift its body like a terrestrial animal, or neck bones that allowed it to turn its neck like terrestrial organisms or a flat head much like terrestrial alligators have today for breathing at the surface. Every single bone in these transitionals we have are just as we call them, theyre morphologically bone intermediates. What fish do you know has neck bones so it can turn its head? What fish do you know has wrist bones that allow it to twist its fins like hands? Its inner ear is that of a terrestrial organism, it had lungs. What fish do you know has lungs? It has fins like a fish, what reptile do you know that has fins like a fish?

And dont get me started on any other intermediates, do you know how hard it is to define reptile like mammals from mammal like reptiles? There are fossils with such intermediate traits, that you cant even logically call it a mammal or a reptile because theyre by definition, both! These are transitional fossils and there are thousands of them.

Edited by JawzofDETH

Share this post


Link to post
Share on other sites

OK, [EDITED OUT]

Where did your akhlaq disappear to? Please be respectful.

Just look at the video and try to disapprove it.

I will once i have time but there is an avalanche of evidence in favour of evolution. I doubt a Sunni convicted criminal without a science degree (who might also be pushing ideas about polytheism)...whose sole educational qualification is interior design will be able to come up with a theory to rival it or indeed even understand what he's talking about.

It doesn't matter if Harun Yahya is a scientist or not, he's got a whole team. You really think he's alone in what he's doing..think again. So there are two things you cannot prove:

If you're presenting your idea as a scientific theory...and you're the principal author of a book about supposed science...it sort of does matter if you are a scientist. Go figure, hey?

On his book only his name is shown. Prove to me that this supposed team of highly qualified scientists exists otherwise it is a reasonable assumption to make that he is doing it alone.

The theory of evolution assumes life developed from a "simple" cell but science today demonstrates that there is no such thing as a simple cell.

-Howard Peth

This is a fundamental misunderstanding of biology. You are basing your entire refutation on a single quotation that you don't even have the qualifications to understand? Can you explain to me what a simple cell is, indeed what a cell is, or how a cell works without having to go out and look it up? Can you detail to me all the different components of a cell without having to go look it up? If you cannot then you cannot really make statements if you do not fully understand them.

This quote is so vague it isn't funny. You can call anything "simple" or "complex". It depends on who's the person determine the complexity of that particular object. The theory of evolution simply isn't about how life developed from a "simple cell" to everything you see today. It’s so much more than this.

What? No such thing as a simple cell..WOW, got to be frustrating.

Not really, even if there’s no such thing as a simple cell it doesn't have much bearing on evolution. This to me illustrates your lack of understanding of evolutionary biology on a fundamental level. How can you possibly understand and argue the intricacies of it when you don’t have sufficient knowledge of the fundamentals? I am not being mean but of course if you don’t understand even the basics, it’s a little hard to debate over the complexities.

Since I'm not a scientist

That’s fine, because i am.

and I don't want to copy paste everything, please take a look at that website I gave and the video's

How about this, i propose a simple reciprocal agreement. I will read your website and watch your videos if you read the chapters out of the book i suggested? Such an arrangement seems fair.

which has no base in today's science.

Um, not to be rude but i am trained in science... i think thats for me to determine. Funny that, a scientist working in science.

Only ignorant people still believe in it who don't even have PROOF.

There are massive amounts of proof. I will show them to you if you genuinely want to learn but if you have already made up your mind and don't want to change it, why should i waste my time? If you genuinely are interested though I’m more than happy to deliver such proof.

So it brings me back to the Quran, which is the ULTIMATE PROOF which NO ONE HAS EVER EVER EVER doubted it's authenticity except the ignorant and stupid people.

So, most of the world is ignorant and stupid just because they don't believe....what you do?

So...we have Issac Newton (a protest), Albert Einstein (jewish), louis pasteur (catholic) - discovered germ theory, Antoine Lavoisier (catholic) - founder of a lot of modern chemistry, Werner heisenberg (lutheran), Marie Curie (catholic), Francis crick (athiest) - codiscovered the structure of DNA, Enrico Fermi (catholic), James Watson (athiest) - codiscovered the structure of DNA along with crick, Jon Von Neuman (catholic) had a lot to do with inventing the modern computer, Richard Feynman (jewish), Stephen Hawking (athiest), Anton van Leeuwenhoek - invented the microscope and opened our eyes to a whole new world of tiny cells and bacteria (protestant), Gregor Mendel (catholic monk) who founded modern genetics, Paul Ehrlich (jewish) - chemotherapy, J. Robert Oppenheimer (jewish) - atomic physics, Jonas Salk (jewish) - invented polio vaccinations that have saved millions and millions of lives, Alexander Fleming (catholic) - discovered antibiotics, bacterial infections were previously untreatable and often fatal, surgery often caused more death than it cured until antibiotics....

But hey...all these are stupid and ignorant people who have contributed absolutely nothing to society since Muslims are obviously superior to all other people.

I don't know why you turned this into a thread about the Quran so i won’t respond to that part. This person was asking about evolution and Islam, not proof for evolution. You derailed this poor people thread. There doesn't need to be a conflict between science and religion as i clearly pointed out. If you want to mistrust or campaign against science out of ignorance or some personal vendetta that is your choice but the two don't have to be in conflict, they can be reconciled. Even the Vatican and the head of the Anglican Church accept evolution. These are serious, skilled, and very smart theologians.

soo Mr.Pumba, coz I don't have time nor I want to really discuss with you, cause you seem like really blinded and you really don't want to see without a bias..

Alternatively, are you possibly bowing out because you know you are in over your head? Just a thought.

I find that statement somewhat ironic, if you really believe that then i really think you dont understand how the scientific method works...

cause it's the strongest and only proof that there is no such thing as monkey's evolving into human beings.. people who say that don't even have ONE, JUST ONE, proof of it..like fish who became land animals..WHERE IN THE HELL are the different stages? Or did they ALL evolve? that's not possible and dumb to say

On the contrary, i can provide at least five different kinds of proof if you are genuinely interested in learning.

let go of Darwin who is now really suffering because of that theory he taught people..

Darwin didn't seem to sin, so that can’t be why God punishes him according to you. Are you implying that God hates scientists, simply because they are scientists?

I don't need to or want to disprove the Quran in this discussion...it isn't even about that.

Did you read the section where i stated numerous philosophical and theological objections to creationism such as God creating viruses that have killed at least 50 billion children? It’s in one of my above posts. Also the fact we are imperfect creatures. God is a perfect being, it is impossible for a perfect being to willingly create something imperfect. Being a perfect being every action he does, every process he sets forth is perfect. If he created us like an artisan, every step in our manufacture would be perfect, because God is perfect. Therefore, we should have turned out perfect and yet we are not. Our knees are prone to easily dislocating, we have a blind spot in our eyes, we are prone to spinal injuries, we have an appendix which is really an evolutionary vestige of a caecum which still remains in herbivores but doesn't have much use in us....i could go on. I think for the believer, naturalistic explanations are actually more comfortable and less confronting than the fact God wrought disease on us and made us imperfect. You should not feel assaulted or insecure because of these theories, they should make you feel even more secure in your faith.

or follow ignorantly what you already hold on to as the truth..your choice.

Anddd you have a nice day too sir.

Edited by JawzofDETH

Share this post


Link to post
Share on other sites

Well I don't believe Adam and Hawa (as) children had to commit incest in order to produce the world population.

Allah (SWT) created Adam as the archetypal man, that is why he is "our father." Not because he is the father of every single person on earth.

I cite this verse in defense: ...We said: "Get ye down, all (ye people), with enmity between yourselves. On earth will be your dwelling-place and your means of livelihood - for a time." - Holy Qur'aan; S2V36

Share this post


Link to post
Share on other sites

Adaptation YES

Evolution NO

I like how the scientists actually take time to explain their responses...and the opposition gives 4 word answers. Why not actually discuss the topic rather than just throwing down 4 words and turning away?

Im here for a discussion, not just random commentary. Lets see what u have...

Share this post


Link to post
Share on other sites

I like how the scientists actually take time to explain their responses...and the opposition gives 4 word answers. Why not actually discuss the topic rather than just throwing down 4 words and turning away?

Im here for a discussion, not just random commentary. Lets see what u have...

He doesn't need to discuss anything.

Evolution lacks sufficient evidence to remain conclusive.

Comparing animals with human beings is also stupid. We're far too sophisticated and our self-awareness is what sets us apart.

Share this post


Link to post
Share on other sites

He doesn't need to discuss anything.

Evolution lacks sufficient evidence to remain conclusive.

Comparing animals with human beings is also stupid. We're far too sophisticated and our self-awareness is what sets us apart.

sure he does, first off, hes not a scientist, nor is he published as a paleontologist. So my guess is, he doesnt know what hes talking about. I want to know, specifically what his issue with evolution is, and yours too for that matter.

I have an evolution topic below my name in which I discuss some of its evidence, and the concepts I pose are beyond sufficient. Go see if you can find flaws in them, or if you want I can re explain them.

For example, if not evolution, then why do phylogenetic trees of various fields such as paleontology and ERV research match up? Do you know what that means? If so, please tell me why they would match up and how this does not prove evolution.

Otherwise, you guys are just talking the talk and not walking the walk. Lets discuss the concepts like adults. When we talk about Islam here we talk about hadiths, we talk about sahih and interpretations and practices. We dont just run around saying "Muhammads the greatest and we love Ali!". No, we discuss the actual material like adults.

Check it out, come on...

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

I have a challenge - and it's a very easy challenge: "If anyone even claims that the Theory of Evolution is false the I would admit that the Theory of Evolution is not a strong hypothesis."

Easy enough. But tere are 2 important stages to beating the challenge:

1. You have to be eligible to take part in the challenge

2. You have to make your claim and give your rationale for it

Requirements for Eligibility

If there are any scientists among you who have gone through academia, are currently doing research in related fields and have grasped the meaning of the Theory of Evolution, and yet dispute the factuality of the Theory, please post why. That is, please explain to us, in the vocabulary of biology, why it is false.

I'm sure we can grant this right to PhDs and Post-doctoral researchers, to provide us with their opinion and rationale.

If you are not such a scientist, then your knowledge is unreliable for us, and we cannot give it any worth.

However, if you are a scientist and moreover disagree with the Theory, kindly teach us through a language we can understand why you disagree.

Provinding references from fringe scientists would not count, since they are in such a minority that it would not undermine the statement: "the Theory of Evolution is not a strong hypothesis."

However, being generous, I am prepared to consider the statement undermined if you happen to be one of those fringe scientists. Please be truthful, as sincerity is the hallmark of a faithful and Godwary human being.

(wasalam)

Share this post


Link to post
Share on other sites

sure he does, first off, hes not a scientist, nor is he published as a paleontologist. So my guess is, he doesnt know what hes talking about. I want to know, specifically what his issue with evolution is, and yours too for that matter.

Finally did it; traded Church dogma for academia worship.

The reverence of the church for the reverence of "the scientist." (But not REAL Science)

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

Arguments and evidence do.

And as for this phylogenetic trees mantra; I've worked with these trees, so I know and have seen that you can get them to pretty much say whatever the hell you want to them to, the input data is not always not broad enough or insufficient to produce any conclusive results from.

Edited by JawzofDETH

Share this post


Link to post
Share on other sites

Finally did it; traded Church dogma for academia worship.

The reverence of the church for the reverence of "the scientist." (But not REAL Science)

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

Arguments and evidence do.

And as for this phylogenetic trees mantra; I've worked with these trees, so I know and have seen that you can get them to pretty much say whatever the hell you want to them to, the input data is almost not broad enough or insufficient to produce any conclusive results from.

You cant really get them to say whatever you want them to because theyre dependent upon the research itself to be developed. For example, find me a t-rex from the silurian. You cant do it. Now do you have a real argument? What do you say about observed mutations? What about observed speciation? What about observed mutations that have become dominant in populations of animals?

These are direct examples of evolution that we have seen with our own eyes. So how might you explain those? Its not just adaptation because there are genetic changes, there is genetic evolution of populations. So what say you about this simple concept?

Share this post


Link to post
Share on other sites

Finally did it; traded Church dogma for academia worship.

The reverence of the church for the reverence of "the scientist." (But not REAL Science)

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

Arguments and evidence do.

And as for this phylogenetic trees mantra; I've worked with these trees, so I know and have seen that you can get them to pretty much say whatever the hell you want to them to, the input data is not always not broad enough or insufficient to produce any conclusive results from.

Also, its interesting how this response essentially is saying "hey scientists are just making stuff up". No im not making up the fossil record, im just observing it. I didnt make this planet, i just look at it and write down what I see. What I see is fossil succession, so by saying that I am wrong, which im not, its like youre trying to undermine the actual existance of creation. Which is not only offensive to the scientists who work hard to record it, but as a religious person you should find it offensive to yourself too, youre essentially undermining an explanation of the nature Allah has created. And if he is watching over us, i dont think he would be happy about such a thing.

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

Arguments and evidence do.

It makes the person more reliable, because an expert in a field has spent golden time in lecture and seminars, learned the concepts, written theses, drooled over the fossils, made a living thinking about them and is therefore more reliable and thorough a person to draw conclusions from the evidence than anyone else.

You'd expect claims of proving the Riemann Hypothesis would be evaluated by expert and reputable mathematicians; quantum theories by theoretical physicists; law by judges; history by historians who have spent years swimming in their material; Arabic by experts in Arabic language and grammar; the same applies to biology.

If you are an expert yourself, please come forward and give your opinion and the rationale behind it. If you are not, then if you're going to take a scientific stance (which you don't need to), have more respect for the scientific ultramajority, because theirs is a theory which has convinced the majority of the experts in that field.

(wasalam)

Share this post


Link to post
Share on other sites

These are direct examples of evolution that we have seen with our own eyes. So how might you explain those? Its not just adaptation because there are genetic changes, there is genetic evolution of populations. So what say you about this simple concept?

Red hair is an example of genetic mutation (and recessive), what's your point?

You saw "the fossil record," so now that's fact which we've seem with our own eyes?

From the same esteemed experts who brought us such conclusive evidence such as' piltdown man?'

Share this post


Link to post
Share on other sites

(bismillah)

(salam)

It makes the person more reliable, because an expert in a field has spent golden time in lecture and seminars, learned the concepts, written theses, drooled over the fossils, made a living thinking about them and is therefore more reliable and thorough a person to draw conclusions from the evidence than anyone else.

Ah thanks buddy :}, next time we get in a philosophical dispute ill take the benefit of the doubt and give you credence. Which I kind of already try to do anyway (even if i dont admit to it) lol.

Red hair is an example of genetic mutation (and recessive), what's your point?

You saw "the fossil record," so now that's fact which we've seem with our own eyes?

From the same esteemed experts who brought us such conclusive evidence such as' piltdown man?'

I was thinking more along the lines of the examples i gave in the topic i made (CCR5, LDL receptor protein mutation). But anyway, the point is, beings, humans included, are mutating. Our DNA is transforming within us, and we are spreading those transformed genes onto our offspring. This is evolution, this is how it works. Physically we are changing ever so slowly over time. And dont try to say "oh its just micro evolution or its just adaptation" because obviously its not adaptation if our dna is ever mutating, and dna changing is dna changing...morphological features changing are morphological features changing. Thats all there is to it, either it is occuring or its not. Im saying it is, and thankfully we can see that it is, therefore we can see that evolution occurs.

And before we move onto the fossil record i want to dig down into this one.

Share this post


Link to post
Share on other sites

And before we move onto the fossil record i want to dig down into this one.

Okay, we are in agreement that our DNA is changing/ mutating etc.

I don't quite see how that translates to being "not adaptation if our dna is ever mutating."

But please continue.

Share this post


Link to post
Share on other sites

Adaptation YES

Evolution NO

You have chanted this mantra in other threads and each of these times i have consistently told you, if you have adaption, you have evolution. Things evolve by a process of adaption, its an automatic correlation. If things adapt then they evolve. There is no two ways about it. If you don't understand this then you don't really understand the basics of evolution, at all.

In which case i would suggest my book or maybe the link in iDevonian's signature.

Evolution lacks sufficient evidence to remain conclusive.

Comparing animals with human beings is also stupid. We're far too sophisticated and our self-awareness is what sets us apart.

There is avalanches of evidence. Why do you think its accepted by pretty much every biologist out there? These certainly aren't stupid people. If there was such a lack of evidence as you describe no serious scientist would believe it, it would be a fringe theory. However, there is an abundance upon an abundance of evidence. Unless you think its some kind of conspiracy... but otherwise, these are smart people and they have good reason to believe what they do.

Comparing animals with human beings? We are animals though. We're in kingdom Animalia, we are animals. This is incontrovertible.

Everyone keeps asking for evidence but no one wants to see it, its such an absurd situation. Just look at some of the evidence that iDevonian has shown you all.

I've said it before and I'll say it again; a piece of paper in your name doesn't make a point of view stronger.

I honestly believe it does. I think a lot of people have a *fundamental* misunderstanding theory of evolution. It's not just one single, isolated simple idea. Darwin didn't even know how changes were passed on for example, it was only when gregor mendel ( a catholic monk who bred pea plants ) discovered genes and this is how change is passed on. So, there are already two things you need to understand. You need to understand genetics (not just at a bare bones level either) to understand evolution. Genetics is about how the DNA simply is though but to understand what the DNA is made of, how the information is stored, processed, copied ect you need biochemistry. I say "biochemistry" or "genetics" like they are small, single focus disciplines, they aren't. I think its often underestimated just how much "stuff" falls under these two headings of areas, theres a huge amount of different things contained within them.

You need knowledge of all these things and more to understand evolution. It simply just doesn't pop out of the sky and into your head. I totally accept you are able to learn without a degree, of course i do. It's a lot harder though and can be muddled up, nonwithstanding the kind of dedication such a thing would require. A degree proves that you've been able and have learned these things though.

Practical experience in a lab greatly helps as well. Reading books is great but it can only get you so far. I've spent Friday afternoons in the lab mashing flies to extract their DNA to separate it out using electricity ( https://en.wikipedia.org/wiki/Gel_electrophoresis ). Obviously, not my idea way to spend my friday afternoons but these kind of sacrifices come along with the process of being educated.These kind of things naturally come along with a degree, time spent learning something. It's also what gives a degree market value, its why university educated people tend to make more, because they have skills and knowledge a lot of other people don't have, the supply is low. Compared to being able to work at your local grocery, which almost everyone can accomplish, you're replaceable and have a huge supply of excess labor.

I think this "piece of paper" does make your view stronger, you wouldn't argue a doctors view is worth less than the average man on the street would you, just based on his piece of paper. I'd quiet like a man with that piece of paper treating me if i ever fall seriously ill. Thats what university is all about, higher learning, learning at a higher, more specialized level.

No one here ever seems to question pretty much any other profession based on a piece of paper except when they have some beef with that profession. Accountants, psychologists, journalists, historians, managers, engineers, town planners, ect. I don't often see people question their qualifications, so its not a problem with an actual degree. It's just that you don't like the views of the professions that happen to be degree educated, in this case biologists. So, i think this criticism is kind of empty unless you're prepared to accept it for all the above people as well.

--------------------------------

--------------------------------

--------------------------------

As in regards to Jebreil, you seem to be very reasonable and respectful in these forums but i do not at all understand your challenge otherwise i would be more than happy to oblige it to you. Could you please clarify?

Are you trying to find a biologist that thinks the theory of evolution is false? They're very few and far between, especially biologists that work on larger things as opposed to people like biochemists. I don't think you'll have much luck finding a person like this, let alone here where people with biological qualifications at all are even more few and far between.

I wouldn't go as far as to say they don't exist but i've read surveys about this on wikipedia, the number is something ridiculously high like 99% of biologists accept the theory of evolution (https://en.wikipedia.org/w/index.php?title=Level_of_support_for_evolution&oldid=470082824 ).

I think just by the nature of the idea, you'd find very few scientists who have went through all that education and dedicated their lives to studying a theory that they don't believe in. I'm sure they think they have better ways to spend their lives. Same with my philosophy of religion professor, apparently athiests are a minority in philosophy of religion, at least in this country because if you don't believe in a God, you're not going to care much either way really (well for most anyway). Same kind of deal.

--------------------------------------

--------------------------------------

--------------------------------------

iDevonian is a geologist so i'll leave the fossil record to him, i could cover it but i think its better i handball it to him.

Like I've said previously, if people actually genuinely don't want to learn or listen and have already hardened their minds prior to seeing and understanding all the evidence, i am not going to throw away my time.

Here is a good place to start - https://en.wikipedia.org/w/index.php?title=Introduction_to_evolution&oldid=472297480 / http://evolution.berkeley.edu/ (evolution 101).

However, the book i mentioned earlier in the thread is a very very good place to start. It shouldn't be too hard to find.

Just for the benefit of those who actually want to learn and the many anonymous people who are bound to come across this by using google (half the reason i ever write stuff here), i'll very very briefly present a couple pieces of evidence. As i said, ill leave the fossils to iDevonian but i'll tackle some of the more...squishy..things.

Still, i absolutely recommend you read those two links above, like i said, evolution isn't an isolated thing, you need to understand many other things to fully grasp evolution, so that kind of knowledge is definitely necessary.

I also realise, without giving everyone a comprehensive background education things might be a bit hard to understand or might not seem like its that important but to cover all those things would take a great deal of time. If theres anything that genuinely needs clarification i'd be happy to oblige. Once again, i recommend those links and very much more so, that book. It's probably the 2nd book i ever used seriously. It's a general biology book, so its not too hard to understand but its written for a college level. Certain knowledge is already assumed from the other chapters, so someone reading those chapters in isolation probably won't understand everything but the good thing about it being a general biology book is that you can go back and read the little bits of the biochemistry or genetics section you need to know. I think i also mentioned a much more simpler (but slightly less comprehensive) high-school level biology book. These are books I've both personally used and i can vouch for them. I don't really think its a wise idea to start recommending books soley on evolutionary biology because of the various things i've mentioned above.

Again, i'll have to considerably simplify things to reach as wide of an audience as i would like to. It might seem at certain points i'm just taking things as a given or that there doesn't seem to be all that much behind a certain idea but i assure you, behind all the things i present, there is. If you would like to know this and if it won't take a hugely extensive explanation, i'll try get to it.

A few very brief points of evidence for evolution occurring

Genetic Sequences

Before i start, as i mentioned above, this is one of the more difficult areas without sufficient background knowledge. Probably one of the most difficult actually.

So, i'm sure we all know we have DNA. You've seen pictures of it, you often hear it mentioned but not many actually know what precisely it is.

It's made up of a couple different parts, most i wont mention here. It has a backbone of sugar-phosphate, which is more or less what it sounds like. Out of this backbone stands the "nucleotides" or "bases". These are basically how information is stored in DNA.

Now DNA is a universal genetic code, this means on a very basic level that it works the same for all forms of life that exist on earth. From the simplest single cell organism right up to things like dinosaurs. It's all fundamentally constructed in the same way.

These bases i mentioned are 4 different chemicals, we represent them as A T G and C. These are the first letters of the chemical they are made of, so A for example is Adenine.

The unique thing here is that A always sticks to T and G always bonds to C. Why they always do this is way beyond the level needed here but you could just think of them being very attractive to each other.

dnabasepairs.jpg

This is what i was talking about earlier. You really need to understand what a "sugar" is and what a phosphate is. What hydrogen bonds are, why two bases are purines and two bases are chemicals called pyrimidines. You need to understand where the nitrogen is in that diagram and how they attatch. There are so many things that are really needed. This is why it isn't exactly an isolated subject.

Again, i'd just like to reiterate why DNA is important. Things obviously change and adapt in evolution but how is that passed onto your children? Your DNA. This is why DNA is of fundamental importance to evolution.

Why is DNA important itself though? You can think of it as a recipe book. Every piece of DNA in your body (simplification) is exactly the same. The DNA in your eyeball has the "recipe" to make a tooth. The DNA in your skin has the recipe to make cardiac proteins in your heart. Why doesn't the "chef" cook all these things for all the cells in your body? Why don't you end up with teeth in your eyes? This is a very important area in genetics and medicine. Often when things are turned off or on when they shouldn't be it causes very serious problems a lot of the time.

DNA is kind of the recipe book to make things called amino acids, string together enough amino acids and you have a protein. This process is called "Translation". You can kind of think of it as a chef "Translating" the words in the recipe book into actual useful food you and i can eat. There are tables out there that you can look up for example (https://en.wikipedia.org/wiki/DNA_codon_table).

See that table, see what is familiar? The A's and the T's and the G's and the C's are in there, these are the things i was previously talking about before.

I can't really explain why in such a short amount of time but when translation occurs, only a single strand of DNA is looked at. Your DNA is split into two strands. Think about why this can work?

Figured it out? Even if we only have one strand of DNA, not stuck to its partner, we can still figure out exactly what its partner would be. If we have a single strand (dna is usually double stranded, hence how it winds around itself) with AATTGCA, we can figure out that the other strand would have TTAACGT because of the rule i mentioned before, how those bases always partner up. This is why if you get a sample of DNA and find out it has 33% of the chemical A, then it must be composed of 33% of the chemical T. Then following that idea out, we must have equal amounts of G and C. Since we are left with 33%, we have 16.5% G and of course, 16.5% C present. I hope this is at least semi-clear to everyone, i know its a lot to take in and often you learn a lot more before you get here.

translationdna.gif

Back to the above linked table. DNA is "read" by the "chef" 3 bases at a time. So the chef looks not at A but at AGC or TTA. This arrangement of 3 bases together is called a "Codon". If you look in the picture, you'll see the "white thing" is attatching to 3 of the "yellow things" at a time. This gives the directions to produce one amino acid. How do we know which amino acid to make? It depends on the sequence, so if we once again refer to the table (https://en.wikipedia.org/wiki/DNA_codon_table), we will find that "TCT" makes an amino acid called Serine. CAA makes an amino acid called Glutamine. We string these amino acids together in a chain to make a protein. A protein is composed of many amino acids linked together.

Heres the key, the genetic material in ALL LIFE (ex very special viruses like HIV but most dont consider viruses to be alive, even in these cases they still indirectly use DNA) is made up of these four bases. We use GTCA. A cheetah uses GTCA and a bacteria uses GTCA. They also make the same proteins. So, "TCT" would make Serine in a human and "TCT" would also make Serine in a pig. This is why it is called a universal genetic code.

This is why genetic engineering works. We use to have to harvest insulin from pigs. It wasn't always the purest or easiest to work with and some people had objections to obtaining it from pigs, rightly so i think. However, we progressed to a point where we could use genetic engineering. We found the particualar gene or "recipe" to make insulin in the pigs DNA. We took it out of the pig and spliced it into the DNA of a bacteria. Guess what, that bacteria started producing an exact replica of porcine (pig) insulin. Without the additional hassle of all the things involved with pigs and we were able to grow bacteria on a much easier and larger scale. Thats the kind of unversality i am talking about. Thats why we're able to put fire fly genes which cause the fly to glow, into plants (totally different kingdom, animal DNA into a plant) and guess what, those plants glow!.

Glowing_tobacco_plant.jpg

This is a tabbaco plant that didn't previously glow. As far as im aware, they spliced in the gene from a firefly and it did exactly the same thing in the tabacco plant, because the genetic code IS universial.

Just very briefly why proteins are important. Think about it, they make up your heart muscle and indeed all your muscles. Your hair, your skin, proteins hold pretty much everything together. They drive most of the chemical reactions in your body, in the form of enzymes. Enzymes are proteins that speed up reactions above their normal rate. Your cells are constantly producing toxins, one is hydrogen perioxide. H2O2. If you left a container of H2O2 on a bench, it would eventually break down to forum H2O (water) and O2 (oxygen). However, this would occur at way too much of a slow rate, it would just keep building up and building up since our cells constantly make it. You would die fairly quickly.

We have a an enzyme (enzymes are made of proteins) called catalase. It kind of actively rips apart the H2O2 into oxygen and water at a much much faster rate. Instead of the slow rate, it rips millions of molecules apart *per second*. One singular, lonely catalase molecule can do several million in one second. This is only one molecule. It would be the equivalent of me gluing together several million blue and red basketballs, throwing them at you and you pulling them apart. How many do you think you, as a single person, could pull apart in one second? Maybe not even one set. This single molecule does millions in a *second*. This is another reason why proteins are important.

So, we've established the genetic code is universal and why proteins matter.

You'll say that this doesn't prove anything! I'm about to get to that.

In his series on the BBC about darwin, richard dawkins (not a great philosopher and i dont really like his attacks on religion but he is a very good biologist) remarked that even if we had no other evidence available to us, comparing the DNA sequences between species would still be overwhelming proof.

We can "sequence" DNA. We can figure out the entire sequence of bases in an organism ATTTAGCAATGCAATGACAAAATAGCA ect ect. Not all of your DNA produces proteins, a lot of it is "junk dna" (not really considered junk anymore but for our purposes it is) and it doesn't produce anything. It's sort of like a recipe book written in a language you cant understand or full of food you hate. Its useless. If we match up our DNA against that of one our closest relatives, the bonobo, we find there is only about a 2% difference when we compare the parts that produce proteins which makes us what we are. So, we share many and many of our genes with them.

To understand why this is important you really need to understand what a species is and how speciation occurs. This is why darwins book was titled the origin of spcies. Understanding the process and ideas of speciation is of fundamental importance.

Say i have a particular population of crabs, these crabs are all the same. Lets say they graze on a certain beach in the carribean. They intermingle and breed which each other just fine. Pretend an earthquake opens up or a volcano errupts and divides this population in two halves, seperated by a rift or mountain of rock. I could errect a fence. The object seperating them doesnt matter all that much. Lets say they feed over a quiet large area but on one side of the fence, there is a species of soft shelled sea snails but these are quiet fast snails. On the right, we have hard shelled snails but they are quiet slow. Within days and months the crabs on both sides are the same. However, on the left, crabs who are faster and perhaps have smaller bodies and claws, would do a better job at catching these fast snails than crabs of normal speed. They'll get more food than the other less fit (in a biology sense, meaning most well adapted for a situation) crabs, they'll have less chance of starving, they'll develop more shiney attractive bodies, they'll be healthier ect.

This is where natural selection comes into play. Variation already must exist in a population to be selected for. Some of us are short, some are tall, we vary. Same with out crabs. Some are very large and slow, some are small but fast. Over time, the smaller faster crabs will be able to get more food, hence be healthier and have less chance of dying, be more sexually attractive and they would reproduce more than the less fit crabs. In the next generation, you'll find you have slightly more smallers, faster crabs than the previous generation. In the next generation, even more slightly smaller crabs than the 1st generation. I hope everyone can understand why this would occur.

Same with the crabs on the right of the fence. They don't need speed. Small and weak clawed crabs (but fast) wouldn't be selected for. In this case, we have very slow but very hard shelled snails. In this area, crabs with huge but powerful claws will get more food, be healther, be less prone to disease, ect than regular crabs. More of these well adapted crabs will survive and reproduce than the less well adapted crabs. Since you get your genes from your parents, their offspring might prosess this trait as well. Since more of our "supercrabs" had more of a chance to breed, more of the next generation would be "supercrabs"/

This is one kind of speciation called allopatric speciation. Literally, "other land" speciation. It occurs when populations seperate ( https://en.wikipedia.org/wiki/Allopatric_speciation ).

What defines a spcies, how do we know if things are the same species? If two animals are able to successfully interbreed and produce fertile offspring, they are the same species. Its why crabs can mate with crabs but not with goldfish. Their number of chromsomes if different, they're physically different, they reproduce differently, they dont recognise each others mating calls ect.

Eventually over time, the crabs on the left and the crabs on the right will become so different they can't interbreed. Neither sides are the same as the original crabs prefence/erruption, these crabs were the ancestors but they no longer exist. We now have two species which have descended from those crabs.

Various reasons why they might not be able to interbreed. Their DNA and number of chromosomes could change so much that it simply wouldn't match up. Afterall, selecting for all these variations and changes results in a change in DNA. Natural mutations and sexual recombination occur over time but would take different paths in these two seperate crab populations. They might not be able to interbreed.

Another reason might be time. The crabs on the left might become noctural and the crabs on the right might not be. They might never get a chance to meet.

Their mating calls could become different because they are seperated (much in the way that you speak arabic only and i speak english only for example) that they might not recognise each other as potential partners and go on to mate.

They could become so physically different mating isn't possible.

One of many reasons.

So, we have two distinct species. They're obviously still crabs but they're different kinds of crabs now. You can tell just by looking that they're more or less the same. They only split off recently, they haven't had much time to change. If you compared their DNA and their proteins many thing would still remain the same because they split off from the same ancestor only recently.

Lets pretend our "superman" crabs on the right again become seperated. We take one and put it on a beach where the snails sting and we leave the others where they are. The crabs on the beach with the stinging snails will once again change, overtime youll see crabs that are more resistant to the stinging (Chilli doesnt at all feel hot to birds for example and yet to us it does). These "Pain-Master" species of crabs that can reduce pain from stinging are more distantly related to the ancestor crabs now. I'm sure we can all see why this is. Even more time has passed, even more changes have taken place. We can compare their DNA and features and see that our "Pain-Master" crabs have less in common with the ancestoral crabs than do our very fast but weak crabs on the left.

So, we can compare the genetic sequence and using this we can infer how recently we split off. This is why the difference between our DNA and bonobos is so small, because we split off so recently (n a biological sense). A human and a mouse? Sure, mouses are still mammals, we have many similarities. We share less in common but we still share a huge amount of DNA. This is why we can use mouse models to test drugs and experiment on. A human and a chicken? Even less related but we still share a fair amount of genes, they're still chordata, which means they have a spinal column. Human and a frog? Still animals, we still share some DNA. Human and Wheat? Totally different biological kingdoms, plantae and animalia yet remarkably, we still share some genes. Every living thing today is interelated to one another. We all come from one common ancestor.

So, thats just one proof that evolution occurs, the similarity in DNA sequences.

Here i showed one example of evolution taking place right infront of our eyes -

Some more here - https://en.wikipedia.org/wiki/Common_descent

https://en.wikipedia.org/wiki/Evidence_of_common_descent

I highly suggest if you're interested you at least read the wikipedia articles but the book is a very good place to look.

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!


Register a new account

Sign in

Already have an account? Sign in here.


Sign In Now

  • Recently Browsing   0 members

    No registered users viewing this page.